Campbell Biology Concepts And Connections 8th Edition By Reece, Taylor – Test Bank

$25.00

Category:

Description

INSTANT DOWNLOAD WITH ANSWERS
Campbell Biology Concepts And Connections 8th Edition By Reece, Taylor – Test Bank

Campbell Biology: Concepts and Connections, 8e (Reece et al.)

Chapter 2   The Chemical Basis of Life

 

2.1   Multiple-Choice Questions

 

1) The four most common elements in living organisms are

  1. A) C, H, O, Fe.
  2. B) C, H, O, Na.
  3. C) C, H, O, N.
  4. D) C, N, O, Na.

Answer:  C

Topic:  2.1

Skill:  Knowledge/Comprehension

Learning Outcome:  2.1

 

2) Which of the following is a trace element in the human body?

  1. A) nitrogen
  2. B) zinc
  3. C) oxygen
  4. D) hydrogen

Answer:  B

Topic:  2.1

Skill:  Knowledge/Comprehension

Learning Outcome:  2.1

 

3) Which of the following statements regarding matter is false?

  1. A) All life is composed of matter.
  2. B) All matter has mass.
  3. C) All matter is composed of elements.
  4. D) All matter exists in the form of compounds.

Answer:  D

Topic:  2.1

Skill:  Knowledge/Comprehension

Learning Outcome:  2.1

 

4) Which of the following statements best describes a compound?

  1. A) A compound is a pure element.
  2. B) A compound contains two or more different elements in a fixed ratio.
  3. C) A compound is exemplified by sodium.
  4. D) A compound is a solution.

Answer:  B

Topic:  2.1

Skill:  Knowledge/Comprehension

Learning Outcome:  2.1

 

5) In the equation 2 H2 + O2 → 2 H2O,

  1. A) H2, O2, and H2O are all compounds.
  2. B) H2, O2, and H2O are all elements.
  3. C) only H2O is a compound.
  4. D) only H2and O2are compounds.

Answer:  C

Topic:  2.1

Skill:  Application/Analysis

Learning Outcome:  2.1

Global LO:  2

 

6) Which of the following trace elements needed by humans is commonly added to table salt?

  1. A) iodine
  2. B) iron
  3. C) magnesium
  4. D) fluoride

Answer:  A

Topic:  2.2

Skill:  Knowledge/Comprehension

Learning Outcome:  2.1

Global LO:  5

 

7) In some areas, fluoride is added during the municipal water treatment process in order to help

  1. A) prevent goiter.
  2. B) prevent the growth of bacteria.
  3. C) prevent the development of mental retardation.
  4. D) reduce tooth decay.

Answer:  D

Topic:  2.2

Skill:  Knowledge/Comprehension

Learning Outcome:  2.1

Global LO:  5

 

8) Which of the following particles are found in the nucleus of an atom?

  1. A) protons and neutrons
  2. B) protons and electrons
  3. C) only protons
  4. D) only electrons

Answer:  A

Topic:  2.3

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

 

9) Electrons move about the nucleus of an atom in the same way that

  1. A) insects fly around a bright lamp at night.
  2. B) cars are parked along the sides of a street.
  3. C) boats cross a lake.
  4. D) birds migrate to a new winter home.

Answer:  A

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2

 

10) What is the atomic mass of an atom that has 6 protons, 6 neutrons, and 6 electrons?

  1. A) 6
  2. B) 8
  3. C) 12
  4. D) 18

Answer:  C

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2, 4

 

11) An uncharged atom of boron has an atomic number of 5 and an atomic mass of 11. How many electrons does boron have?

  1. A) 11
  2. B) 15
  3. C) 5
  4. D) 2

Answer:  C

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2

 

12) Which of the following is another term used for atomic mass?

  1. A) darwin
  2. B) mendel
  3. C) dalton
  4. D) calvin

Answer:  C

Topic:  2.3

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

 

13) The sodium atom contains 11 electrons, 11 protons, and 12 neutrons. What is the mass number of sodium?

  1. A) 11
  2. B) 22
  3. C) 23
  4. D) 34

Answer:  C

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2, 4

 

14) Which of the following best describes the atomic number of an atom?

  1. A) the number of protons in the atom
  2. B) the number of electrons in the atom
  3. C) the number of neutrons in the atom
  4. D) the number of protons, electrons, and neutrons in the atom

Answer:  A

Topic:  2.3

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

 

15) Typically, nitrogen atoms are composed of electrons, protons, and neutrons. An isotope of nitrogen could

  1. A) be positively charged.
  2. B) be negatively charged.
  3. C) have more protons than the usual nitrogen atom.
  4. D) have more neutrons than the usual nitrogen atom.

Answer:  D

Topic:  2.3

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

 

16) A radioactive isotope is an isotope that

  1. A) is stable.
  2. B) decays.
  3. C) has more protons than the common variant of the element.
  4. D) has the same atomic mass but a different atomic number than the common variant of the element.

Answer:  B

Topic:  2.3

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

 

17) If you found a fossilized dinosaur bone, what could be done to determine the age of the fossil?

  1. A) Extract and sequence DNA from the bone.
  2. B) Look at pieces of the bone under a microscope.
  3. C) Analyze the isotopes of carbon in the fossil.
  4. D) Compare the appearance of the bone to other fossilized bones.

Answer:  C

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2

 

18) Which of the following statements about radioactive isotopes is true?

  1. A) The nuclei of radioactive isotopes are unusually stable, but the atoms tend to lose electrons.
  2. B) When given a choice between radioactive and nonradioactive isotopes of the same atom, living cells are more likely to incorporate the radioactive isotopes into their structures.
  3. C) The energy emitted by radioactive isotopes can break chemical bonds and cause molecular damage in cells.
  4. D) Radioactive elements are natural and therefore not harmful.

Answer:  C

Topic:  2.4

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

 

19) Radioactive isotopes

  1. A) are frequently added to foods as nutritional supplements.
  2. B) can be used in conjunction with PET scans to diagnose diseases.
  3. C) do not occur naturally.
  4. D) are never incorporated into organic compounds.

Answer:  B

Topic:  2.4

Skill:  Knowledge/Comprehension

Learning Outcome:  2.2

Global LO:  5

 

20) When full, the innermost electron shell of argon contains ________ electrons, and the outermost shell contains ________ electrons.

  1. A) 2; 2
  2. B) 2; 8
  3. C) 4; 8
  4. D) 8; 8

Answer:  B

Topic:  2.5

Skill:  Knowledge/Comprehension

Learning Outcome:  2.3

 

21) What happens to an atom if the electrons in the outer shell are altered?

  1. A) The atom becomes radioactive.
  2. B) The atom disintegrates.
  3. C) The properties of the atom change.
  4. D) The atom’s characteristics change, and it becomes a different element.

Answer:  C

Topic:  2.5

Skill:  Knowledge/Comprehension

Learning Outcome:  2.3

 

22) A(n) ________ forms when two atoms share electrons.

  1. A) ion
  2. B) covalent bond
  3. C) ionic bond
  4. D) hydrogen bond

Answer:  B

Topic:  2.6

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4

 

23) A hydrogen atom has one electron. How many covalent bonds can hydrogen form?

  1. A) one
  2. B) two
  3. C) four
  4. D) none

Answer:  A

Topic:  2.6

Skill:  Application/Analysis

Learning Outcome:  2.4

Global LO:  2

 

24) Table salt is formed when

  1. A) chlorine gives an electron to sodium.
  2. B) a hydrogen bond forms between sodium and chlorine.
  3. C) sodium and chlorine share electrons to form a bond.
  4. D) sodium donates its single outer electron to chlorine.

Answer:  D

Topic:  2.7

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4

 

25) The body uses atoms in different ways to accomplish different tasks. For example, one portion of the body’s calcium supply strengthens bones, whereas another portion combines with proteins to stimulate blood clotting after tissue injury. Which of the following statements provides the most logical chemical explanation of calcium’s ability to perform such different functions?

  1. A) The bone contains calcium salts, which are less reactive than the calcium ions found in the blood.
  2. B) The calcium in blood is a more reactive form of the atom and therefore has fewer protons than the calcium in bone.
  3. C) There are many different isotopes of calcium, and the most reactive isotope is found in the bone.
  4. D) The calcium in blood has a lighter atomic mass than the calcium in bone and is in a more reactive form.

Answer:  A

Topic:  2.7

Skill:  Synthesis/Evaluation

Learning Outcome:  2.4

Global LO:  2

 

26) Medicines are often administered in pill form. In many cases, the active ingredient of the pill (the drug) is joined to another substance by ________. This forms a(n) ________, which is stable in the dry environment of a pill bottle but dissociates under the wet conditions of the digestive system to release the drug to the body.

  1. A) ionic bonds; salt
  2. B) hydrogen bonds; base
  3. C) ionic bonds; acid
  4. D) covalent bonds; salt

Answer:  A

Topic:  2.7

Skill:  Application/Analysis

Learning Outcome:  2.4

Global LO:  2

 

27) What is the fundamental difference between covalent and ionic bonding?

  1. A) In a covalent bond, the partners share a pair of electrons; in an ionic bond, one partner accepts electrons from the other.
  2. B) In covalent bonding, both partners end up with filled outer electron shells; in ionic bonding, one partner does and the other does not.
  3. C) Covalent bonding involves only the outermost electron shell; ionic bonding also involves the next electron shell inside the outermost shell.
  4. D) Covalent bonds form between atoms of the same element; ionic bonds form between atoms of different elements.

Answer:  A

Topic:  2.6, 2.7

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4

28) Which of the following statements regarding the oxygen atom of a water molecule is true?

  1. A) Oxygen is more positively charged than the hydrogen atoms.
  2. B) Oxygen attracts electrons less strongly than the hydrogen atoms.
  3. C) Oxygen is more electronegative than the hydrogen atoms.
  4. D) Oxygen is attracted to the negatively charged atoms of other molecules.

Answer:  C

Topic:  2.8

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4, 2.5

 

29) In a water molecule, hydrogen and oxygen are held together by a ________ bond.

  1. A) double covalent
  2. B) nonpolar covalent
  3. C) hydrogen
  4. D) polar covalent

Answer:  D

Topic:  2.8

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4, 2.5

 

30) A single water molecule (H—O—H) is held together by

  1. A) a single covalent bond.
  2. B) a double covalent bond.
  3. C) two polar covalent bonds.
  4. D) hydrogen bonds.

Answer:  C

Topic:  2.8

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4, 2.5

 

31) The hydrogen atoms of a water molecule are bonded to the oxygen atom by ________ bonds, whereas neighboring water molecules are held together by ________ bonds.

  1. A) hydrogen; polar covalent
  2. B) polar covalent; hydrogen
  3. C) ionic; covalent
  4. D) polar covalent; ionic

Answer:  B

Topic:  2.8

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4, 2.5

 

 

32) ________ are weak bonds that are not strong enough to hold atoms together to form molecules but are strong enough to form bonds within and around large molecules.

  1. A) Ionic bonds
  2. B) Covalent bonds
  3. C) Polar covalent bonds
  4. D) Hydrogen bonds

Answer:  D

Topic:  2.8

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4, 2.5

33) Water molecules stick to other water molecules because

  1. A) water molecules are neutral, and neutral molecules are attracted to each other.
  2. B) hydrogen bonds form between the hydrogen atoms of one water molecule and the oxygen atoms of other water molecules.
  3. C) covalent bonds form between the hydrogen atoms of one water molecule and the oxygen atoms of other water molecules.
  4. D) the oxygen atoms of adjacent water molecules are attracted to one another.

Answer:  B

Topic:  2.8

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4, 2.5, 2.6

 

34) Which of the following statements regarding chemical reactions is false?

  1. A) Chemical reactions involve the making and breaking of chemical bonds.
  2. B) Some chemical reactions create electrons; others destroy them.
  3. C) The reactants contain the same number of atoms as the products.
  4. D) Although the atoms of a reaction’s reactants and products are identical to each other, their molecular formulas differ.

Answer:  B

Topic:  2.9

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4

 

35) In the equation 2 H2 + O2 → 2 H2O, the H2 molecules are ________ and the H2O molecules are ________.

  1. A) reactants; products
  2. B) products; reactants
  3. C) created; destroyed
  4. D) used; stored

Answer:  A

Topic:  2.9

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4

 

 

36) In plants, the process of photosynthesis produces glucose (C6H12O6) and oxygen from carbon dioxide and water. Which of the following statements about photosynthesis is true?

  1. A) All of the carbon atoms from the carbon dioxide atoms are found in glucose.
  2. B) More atoms are present at the beginning than at the end.
  3. C) More carbon dioxide is released from the plant than is absorbed.
  4. D) Water is synthesized by the plant from H2and O2.

Answer:  A

Topic:  2.9

Skill:  Knowledge/Comprehension

Learning Outcome:  2.4

37) The tendency of water molecules to stick together is referred to as

  1. A) adhesion.
  2. B) polarity.
  3. C) cohesion.
  4. D) transpiration.

Answer:  C

Topic:  2.10

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

 

38) Water’s surface tension and heat storage capacity are accounted for by its

  1. A) orbitals.
  2. B) hydrogen bonds.
  3. C) mass.
  4. D) size.

Answer:  B

Topic:  2.10, 2.11

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

 

39) The temperature of evaporation is much higher for water than for alcohol. Without knowing more about the chemistry of alcohol, which of the following is the most logical chemical explanation for this phenomenon?

  1. A) Ionic bonds form between alcohol molecules. These are the weakest type of bond and are easier to break than the hydrogen bonds between water molecules.
  2. B) Alcohol has a higher surface tension than water. This means that alcohol molecules can easily break away from other alcohol molecules and evaporate at a lower temperature.
  3. C) Alcohol molecules are more cohesive than water molecules. This means that as alcohol molecules evaporate, they pull other alcohol molecules into the air along with them.
  4. D) Fewer hydrogen bonds form between alcohol molecules. As a result, less heat is needed for alcohol molecules to break away from solution and enter the air.

Answer:  D

Topic:  2.11

Skill:  Application/Analysis

Learning Outcome:  2.6

Global LO:  2

 

40) As ice melts,

  1. A) hydrogen bonds are broken.
  2. B) water molecules become less tightly packed.
  3. C) the water becomes less dense.
  4. D) heat is released.

Answer:  A

Topic:  2.12

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

41) Which of the following statements about water is false?

  1. A) Ice is more dense than liquid water.
  2. B) Water naturally exists in all three physical states on Earth.
  3. C) Floating ice on a pond insulates the liquid water below, slowing its rate of freezing.
  4. D) If ice sank, the oceans would eventually freeze solid.

Answer:  A

Topic:  2.12

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

 

42) You’ve made a hot drink by dissolving a teaspoon of instant coffee and a teaspoon of sugar in a cup of hot water. Which of the following statements is true?

  1. A) You’ve just prepared an aqueous solution.
  2. B) The water is the solute portion of the drink.
  3. C) The instant coffee and sugar are solvents.
  4. D) The instant coffee and sugar dissolve because they have no charged regions to repel the partial positive and partial negative regions of the water molecules.

Answer:  A

Topic:  2.13

Skill:  Application/Analysis

Learning Outcome:  2.6

Global LO:  2

 

43) Which of the following is dependent on the ability of water molecules to form hydrogen bonds with other molecules besides water?

  1. A) the evaporative cooling of skin surfaces
  2. B) the milder temperatures of coastal regions compared to inland areas
  3. C) the ability of certain insects to walk on the surface of water
  4. D) the universality of water as a solvent

Answer:  D

Topic:  2.10, 2.11, 2.13

Skill:  Application/Analysis

Learning Outcome:  2.6

Global LO:  2

 

 

44) Clots in our blood can lead to a heart attack or stroke by blocking blood flow. If a clot were made up of a mass of proteins, what changed in the proteins to cause them to form the clot?

  1. A) The proteins became more polar.
  2. B) The blood became saturated with proteins.
  3. C) The proteins were no longer soluble in the blood.
  4. D) The proteins became more soluble in the blood.

Answer:  C

Topic:  2.13

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

Global LO:  2, 5

45) A pharmaceutical company hires a chemist to analyze the purity of the water being used in its drug preparations. If the water is pure, the chemist would expect to find

  1. A) only molecules of H2
  2. B) H2O molecules and H+
  3. C) H2O molecules, H+ions, and OH-
  4. D) only H+ions and OH-

Answer:  C

Topic:  2.14

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

 

46) A solution with a pH of 7 is

  1. A) strongly acidic.
  2. B) weakly acidic.
  3. C) neutral.
  4. D) weakly basic.

Answer:  C

Topic:  2.14

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

 

47) Compared to a solution of pH 3, a solution of pH 1 is

  1. A) 100 times more acidic.
  2. B) 10 times more acidic.
  3. C) 10 times more basic.
  4. D) 100 times more basic.

Answer:  A

Topic:  2.14

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

Global LO:  4

 

 

48) Which of the following statements about pH is true?

  1. A) The pH scale is a measure of oxygen ion concentration.
  2. B) A single unit change on the pH scale is equivalent to a 1% change in hydrogen ion concentration.
  3. C) An increase in hydrogen ion concentration means a decrease in pH scale units.
  4. D) Basic pH levels are less than 7.

Answer:  C

Topic:  2.14

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

49) Household ammonia has a pH of 12; household bleach has a pH of 13. Which of the following statements about these substances is true?

  1. A) Both of these substances are strong acids.
  2. B) The ammonia has 10 times as many OH-ions as the bleach.
  3. C) The ammonia has 10 times as many H+ions as the bleach.
  4. D) A solution that could buffer the bleach and ammonia would remove excess OH-

Answer:  C

Topic:  2.14

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

Global LO:  4

 

50) A buffer

  1. A) is an acid that is used to offset overly basic conditions in the body.
  2. B) is a base that is used to offset overly acidic conditions in the body.
  3. C) donates H+ions when conditions become too basic and accepts H+ions when conditions become too acidic.
  4. D) donates OH-ions when conditions become too basic and accepts OH-ions when conditions become too acidic.

Answer:  C

Topic:  2.14

Skill:  Knowledge/Comprehension

Learning Outcome:  2.6

 

 

51) A diabetic, who does not utilize insulin properly, will metabolize fats instead of glucose. A condition called diabetic ketoacidosis is a common result of excessive fat metabolism, causing blood pH values of 7.1 or less (normal range is 7.35-7.45). What has happened to the blood pH and why?

  1. A) The pH is above normal (basic) because the ketones are too basic.
  2. B) The pH is below normal (acidic) because the buffering capacity was exceeded.
  3. C) The pH is not affected because the blood buffers can absorb the excess H+.
  4. D) The pH is below normal because buffers can donate OH+.

Answer:  B

Topic:  2.14

Skill:  Application/Analysis

Learning Outcome:  2.6, 2.7

Global LO:  2, 5

 

52) Which of the following hypotheses would be supported if liquid water were found on Mars and contained evidence of bacteria-like organisms?

  1. A) Life must evolve in the presence of oxygen.
  2. B) The chemical evolution of life is possible.
  3. C) Life on Earth must have originated on Mars.
  4. D) Life is guided by intelligent design.

Answer:  B

Topic:  2.16

Skill:  Application/Analysis

Learning Outcome:  2.7

Global LO:  2

53) Silicon is an element that is found directly underneath carbon in the periodic table. How many electrons are in the valence shell of a silicon atom?

  1. A) 1
  2. B) 2
  3. C) 4
  4. D) 6

Answer:  C

Topic:  2.5

Skill:  Application/Analysis

Learning Outcome:  2.3

Global LO:  2

 

 

54) Consider the following situations: (1) a magnesium atom and two chlorine atoms join together to form a molecule of magnesium chloride; (2) water molecules interact with each other in a beaker; and (3) two carbon atom and six hydrogen atoms join together to form ethane. Rank the strength of the bonding interactions taking place in each situation, from the weakest bonds to the strongest bonds.

  1. A) 1 < 2 < 3
  2. B) 3 < 2 < 1
  3. C) 2 < 3 < 1
  4. D) 2 < 1 < 3

Answer:  D

Topic:  2.6, 2.7, 2.8

Skill:  Synthesis/Evaluation

Learning Outcome:  2.4

Global LO:  2

 

55) In ocean acidification, dissolving CO2 gas ________ the pH of the ocean.

  1. A) lowers
  2. B) does not affect
  3. C) raises
  4. D) triples

Answer:  A

Topic:  2.15

Skill:  Knowledge/Comprehension

Learning Outcome:  2.7

 

56) How will a lower ocean pH caused by ocean acidification affect coral reefs?

  1. A) Coral reefs will grow faster because there are more carbonate ions available.
  2. B) Coral reefs will grow slower because there are fewer carbonate ions available.
  3. C) Coral reefs will grow faster because there are more bicarbonate ions available.
  4. D) Coral reefs will grow slower because there are fewer bicarbonate ions available.

Answer:  B

Topic:  2.15

Skill:  Knowledge/Comprehension

Learning Outcome:  2.7

 

57) Glycolysis is the first step of cellular respiration, in which glucose is used to generate ATP to power the cell. The major chemical reaction that takes place in glycolysis (ignoring some other reactants and products) is the conversion of glucose (C6H12O6) to pyruvate (C3H4O3) and hydrogen ions (H+). Using this information, what is the correct equation for the glycolysis chemical reaction?

  1. A) C6H12O6→ C3H4O3+ H+
  2. B) C6H12O6→ 2 C3H4O3+ 2 H+
  3. C) C6H12O6→ 2 C3H4O3+ H+
  4. D) 2 C6H12O6→ C3H4O3+ 2 H+

Answer:  B

Topic:  2.9

Skill:  Application/Analysis

Learning Outcome:  2.4

Global LO:  2, 4

 

58) Household ammonia, or ammonium hydroxide, is a mixture of ammonia (NH3) and water. What types of bonding interactions will occur between molecules of ammonia and water in a bottle of household ammonia?

  1. A) polar covalent bonds between positively charged nitrogen atoms in ammonia and negatively charged oxygen atoms in water
  2. B) polar covalent bonds between negatively charged nitrogen atoms in ammonia and positively charged hydrogen atoms in water
  3. C) hydrogen bonds between positively charged nitrogen atoms in ammonia and negatively charged oxygen atoms in water
  4. D) hydrogen bonds between negatively charged nitrogen atoms in ammonia and positively charged hydrogen atoms in water

Answer:  D

Topic:  2.8

Skill:  Application/Analysis

Learning Outcome:  2.4

Global LO:  2

 

 

59) A nutrition facts label from a fortified cereal states that in a single serving of cereal there is 8% of the percent daily value of the element phosphorous. The label also says that a single serving of cereal plus one-half cup of skim milk has 20% of the percent daily value of phosphorus. Which of the following statements is false?

  1. A) A half-cup of skim milk contains 12% of the percent daily value of phosphorus.
  2. B) A half-cup of skim milk contains twice as much phosphorus as a serving of cereal.
  3. C) Eating five servings of cereal and two and a half cups of skim milk will give you 100% of the phosphorus that you need for one day.
  4. D) The amount of phosphorus in six servings of cereal is equal to the amount of phosphorus in two cups of skim milk.

Answer:  B

Topic:  2.2

Skill:  Application/Analysis

Learning Outcome:  2.1

Global LO:  2, 4

2.2   Art Questions

 

1) What change is occurring in this figure?

 

  1. A) Chlorine is losing an electron.
  2. B) Sodium is becoming negatively charged.
  3. C) Sodium is filling its third electron shell.
  4. D) Chlorine is filling its third electron shell.

Answer:  D

Topic:  2.7

Skill:  Knowledge/Comprehension

Learning Outcome:  2.3, 2.4

Global LO:  3

 

2) The figure below shows five water molecules. The hydrogen bonds shown in this figure are each

 

  1. A) between two hydrogen atoms.
  2. B) between an oxygen and a hydrogen atom of the same water molecule.
  3. C) between an oxygen and a hydrogen atom of different water molecules.
  4. D) between two atoms with the same charge.

Answer:  C

Topic:  2.8

Skill:  Application/Analysis

Learning Outcome:  2.4

Global LO:  2, 3

 

3) Below is the structure of octane, the major component of gasoline. What type(s) of bond is (are) found in a molecule of octane?

 

  1. A) only nonpolar covalent bonds
  2. B) only polar covalent bonds
  3. C) hydrogen bonds and polar covalent bonds
  4. D) ionic bonds and nonpolar covalent bonds

Answer:  A

Topic:  2.6

Skill:  Application/Analysis

Learning Outcome:  2.4, 2.5

Global LO:  2

 

4) Below is the structure of leucine, an amino acid. What type of bond is the arrow pointing to?

 

  1. A) a nonpolar covalent bond
  2. B) a polar covalent bond
  3. C) an ionic bond
  4. D) a hydrogen bond

Answer:  B

Topic:  2.6

Skill:  Application/Analysis

Learning Outcome:  2.4, 2.5

Global LO:  2

 

5) Below is a figure from an experiment that was performed to measure the effect of carbonate ion (CO32-) concentration on the calcification (growth) rate of coral reefs. At which point on the graph is the ocean pH the lowest?

 

  1. A) A
  2. B) B
  3. C) C
  4. D) D

Answer:  A

Topic:  2.15

Skill:  Synthesis/Evaluation

Learning Outcome:  2.6

Global LO:  2, 3

 

2.3   Scenario Questions

 

After reading the paragraph below, answer the questions that follow.

 

You’ve been experiencing acid indigestion lately, and you’d like a quick fix for the problem. You do a little research on the Internet and discover that your problem is caused by excess stomach acid. In the pharmacy aisles, however, you’re having a little trouble deciding what to purchase to address the problem. At the pharmacy counter, the clerk recommends that you purchase PEPCID AC or Alka-Seltzer tablets.

 

1) If you could check the pH of the recommended tablets, you would expect it to be

  1. A) higher than 7.
  2. B) lower than 7.
  3. C) exactly 7.
  4. D) pH neutral.

Answer:  A

Topic:  2.14

Skill:  Application/Analysis

Learning Outcome:  2.6

Global LO:  2

 

2) If you were able to chemically analyze your stomach fluids 30 minutes after taking two tablets, you would find

  1. A) more hydrogen ions.
  2. B) fewer hydrogen ions.
  3. C) the same number of hydrogen ions.
  4. D) that the pH in your stomach has decreased.

Answer:  B

Topic:  2.14

Skill:  Application/Analysis

Learning Outcome:  2.6

Global LO:  2, 5, 6

 

 

3) You want to design a controlled experiment to determine which tablet, PEPCID AC or Alka-Seltzer, neutralizes stomach acid the quickest. Which of the following experiments would be the best to perform?

  1. A) Place a PEPCID AC tablet in a beaker of acid at pH 2 and an Alka-Seltzer tablet in a separate beaker of acid at pH 2 and check the pH in the beakers every 2 minutes.
  2. B) Take a PEPCID AC tablet at 8:00 am on Monday and take an Alka-Seltzer tablet at 8:00 am on Tuesday and take note of how long it takes you to feel better.
  3. C) Find a group of your friends and go out to a big dinner. Then give half of them a PEPCID AC tablet and give the other half an Alka-Seltzer tablet and tell them to write down how long it takes them to feel better.
  4. D) Place a PEPCID AC tablet in a beaker of acid at pH 2 and an Alka-Seltzer tablet in a separate beaker of acid at pH 2 and record how long it takes for the tablets to dissolve.

Answer:  A

Topic:  2.14

Skill:  Synthesis/Evaluation

Learning Outcome:  2.6

Global LO:  1, 2

4) You hypothesize that a tablet of PEPCID AC can neutralize more stomach acid than a tablet of Alka-Seltzer. If you placed a tablet of each antacid in a beaker of acid at an initial pH of 2, which of the following experimental results would support your hypothesis?

  1. A) After 1 hour, the pH of the solution in the PEPCID AC beaker was 9.2 and the pH of the solution in the Alka-Seltzer beaker was 8.3.
  2. B) After 1 hour, the pH of the solution in the PEPCID AC beaker was 7.9 and the pH of the solution in the Alka-Seltzer beaker was 9.6.
  3. C) After 1 hour, the pH of the solution in the PEPCID AC beaker was equal to that of the pH of the solution in the Alka-Seltzer beaker.
  4. D) It took 3 minutes for the PEPCID AC tablet to fully dissolve and it took 5 minutes for the Alka-Seltzer tablet to fully dissolve.

Answer:  A

Topic:  2.14

Skill:  Synthesis/Evaluation

Learning Outcome:  2.6

Global LO:  1, 2

 

5) You want to design an experiment to compare the effectiveness of Pepcid AC tablets and Alka-Seltzer tablets. Which of the following facts would be least likely to complicate your experiment and the analysis of your results?

  1. A) PEPCID AC and Alka-Seltzer tablets contain different concentrations of the antacid drug.
  2. B) PEPCID AC and Alka-Seltzer tablets contain different ingredients.
  3. C) The recommended dosage for PEPCID AC and Alka-Seltzer tablets is different.
  4. D) PEPCID AC and Alka-Seltzer tablets are sold in different countries throughout the world.

Answer:  D

Topic:  2.14

Skill:  Synthesis/Evaluation

Learning Outcome:  2.6

Global LO:  1, 2

 

After reading the paragraph below, answer the questions that follow.

 

Uranium is a metallic element that is used in nuclear reactors and nuclear weapons. The vast majority of uranium found on Earth is in the form of uranium-238, an isotope with a mass number of 238, while the uranium that is used for nuclear reactors and weapons is uranium-235, an isotope with a mass number of 235.

 

6) What is the atomic difference between uranium-235 and uranium-238?

  1. A) Uranium-235 has three fewer protons than uranium-238.
  2. B) Uranium-235 has three fewer neutrons than uranium-238.
  3. C) Uranium-235 has three fewer electrons than uranium-238.
  4. D) Uranium-235 has three fewer atoms than uranium-238.

Answer:  B

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2, 5

7) If the atomic mass of uranium is 92, how many neutrons does an atom of uranium-235 have in its nucleus?

  1. A) 92
  2. B) 143
  3. C) 146
  4. D) 235

Answer:  B

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2, 4, 5

 

8) In a certain type of nuclear reactor, uranium-238 can be converted to plutonium-239, another radioactive element (with an atomic number of 94) that can be used to power nuclear reactions. Which of the following statements regarding uranium-238 and plutonium-239 is false?

  1. A) An atom of plutonium-239 contains one more proton than an atom of uranium-238.
  2. B) An atom of plutonium-239 contains 145 neutrons.
  3. C) An atom of uranium-238 has a smaller mass than an atom of plutonium-239.
  4. D) An atom of plutonium-239 contains two more protons and one fewer neutron than an atom of uranium-238.

Answer:  A

Topic:  2.3

Skill:  Application/Analysis

Learning Outcome:  2.2

Global LO:  2, 4, 5

 

Campbell Biology: Concepts and Connections, 8e (Reece et al.)

Chapter 12   DNA Technology and Genomics

 

12.1   Multiple-Choice Questions

 

1) Biotechnology

  1. A) is a modern scientific discipline that has existed for only a few decades.
  2. B) is strictly concerned with the manipulation of DNA.
  3. C) has been around since the dawn of civilization.
  4. D) is generally considered more harmful than valuable to society.

Answer:  C

Topic:  12.1

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

Global LO:  5

 

2) When DNA from two sources is combined into one single piece of DNA, it is known as

  1. A) cloned DNA.
  2. B) recombinant DNA.
  3. C) a vector.
  4. D) a plasmid.

Answer:  B

Topic:  12.1

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

Global LO:  5

 

3) The production of multiple identical copies of gene-sized pieces of DNA defines

  1. A) gene cloning.
  2. B) transformation.
  3. C) DNA technology.
  4. D) genetic engineering.

Answer:  A

Topic:  12.1

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

Global LO:  5

 

 

4) In the process of human gene cloning using plasmids, the bacterial plasmid

  1. A) is used as the vector.
  2. B) is the source of the gene to be cloned.
  3. C) is cultured inside the human cell, which contains the gene to be cloned.
  4. D) is used to insert the human gene into the bacterial chromosome.

Answer:  A

Topic:  12.1

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

Global LO:  6

5) DNA ligase binds

  1. A) recombinant DNA to transformed bacterial cells.
  2. B) recombinant DNA to recombinant proteins.
  3. C) nucleotides in the DNA backbone together.
  4. D) nucleotide base pairs together.

Answer:  C

Topic:  12.1

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

 

6) When plasmids are used to produce a desired protein,

  1. A) the plasmids are inserted into the bacterial chromosome.
  2. B) the plasmids multiply and produce the protein outside of the bacterium.
  3. C) the desired gene is inserted into the plasmid, and the plasmid is returned to the bacterium by transformation.
  4. D) the bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene (often the cell of a plant or animal).

Answer:  C

Topic:  12.1

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

Global LO:  5, 6

 

7) ________ are a major source of restriction enzymes.

  1. A) Plant cells
  2. B) Human cells
  3. C) Archaea cells
  4. D) Bacterial cells

Answer:  D

Topic:  12.2

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

 

 

8) Restriction enzymes

  1. A) facilitate nucleotide base pairing.
  2. B) cut DNA at specific sites.
  3. C) stop transcription and translation.
  4. D) bind together strands of DNA.

Answer:  B

Topic:  12.2

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

 

9) Restriction enzymes specifically recognize and cut short sequences of DNA called

  1. A) introns.
  2. B) exons.
  3. C) sticky ends.
  4. D) restriction sites.

Answer:  D

Topic:  12.2

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

10) “Sticky ends” are

  1. A) produced by the action of DNA ligase.
  2. B) produced by PCR.
  3. C) always long sequences of a single nucleotide.
  4. D) DNA fragments with single-stranded ends.

Answer:  D

Topic:  12.2

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

 

11) The feature of “sticky ends” that makes them especially useful in DNA recombination is their ability to

  1. A) bind to DNA and thereby activate transcription.
  2. B) bind to ribosomes and thereby activate translation.
  3. C) form hydrogen-bonded base pairs with complementary single-stranded stretches of DNA.
  4. D) allow plasmids to attach to the main bacterial chromosome.

Answer:  C

Topic:  12.2

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

 

 

12) After DNA fragments with matching sticky ends are temporarily joined by complementary base pairing, the union can be made permanent by the “pasting” enzyme

  1. A) DNA ligase.
  2. B) DNA polymerase.
  3. C) DNA helicase.
  4. D) ATP methylase.

Answer:  A

Topic:  12.2

Skill:  Knowledge/Comprehension

Learning Outcome:  12.1

 

13) The ________ approach to gene cloning employs a mixture of fragments from the entire genome of an organism and results in the production of thousands of different recombinant plasmids.

  1. A) shotgun
  2. B) genetic engineering
  3. C) restriction
  4. D) cloning

Answer:  A

Topic:  12.19

Skill:  Knowledge/Comprehension

Learning Outcome:  12.9

Global LO:  5

14) Which of the following is the best definition of a genomic library?

  1. A) a collection of cloned DNA fragments that includes some parts of organism’s genome
  2. B) a collection of cloned DNA fragments that includes an organism’s entire genome
  3. C) a collection of cloned DNA fragments that includes multiple organisms’ genomes
  4. D) a collection of cloned DNA fragments that includes only exons from an organism’s genome

Answer:  B

Topic:  12.3

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

Global LO:  5

 

15) Genomic libraries can be constructed using either bacterial plasmids or what other vector?

  1. A) ribosomes
  2. B) tRNA
  3. C) human chromosomes
  4. D) bacteriophages

Answer:  D

Topic:  12.3

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

Global LO:  6

 

 

16) The enzyme that converts information stored in RNA to information stored in DNA is

  1. A) DNA ligase.
  2. B) reverse transcriptase.
  3. C) a restriction enzyme.
  4. D) RNA polymerase.

Answer:  B

Topic:  12.4

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

 

17) A cDNA library differs from a genomic library in that

  1. A) the cDNA was constructed from introns only.
  2. B) genomic libraries are only stored in bacterial cells.
  3. C) cDNA libraries are more stable.
  4. D) cDNA libraries only contain information from genes that have been transcribed.

Answer:  D

Topic:  12.4

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

 

18) An advantage of using reverse transcriptase to prepare a gene for cloning is that

  1. A) reverse transcriptase is more efficient than RNA polymerase.
  2. B) the resulting DNA strand will lack exons.
  3. C) reverse transcriptase is more efficient than DNA polymerase.
  4. D) the resulting DNA strand will lack introns.

Answer:  D

Topic:  12.4

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

19) A nucleic acid probe is

  1. A) a virus that transfers DNA to a recipient cell.
  2. B) a piece of radioactively labeled DNA that is used to locate a specific gene.
  3. C) an enzyme that locates a specific restriction site on RNA.
  4. D) a plasmid that recognizes a specific DNA sequence.

Answer:  B

Topic:  12.5

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

 

 

20) Which of the following statements about nucleic acid probes is false?

  1. A) A nucleic acid probe is a double-stranded section of DNA.
  2. B) A nucleic acid probe can be used to find a specific gene.
  3. C) A nucleic acid probe binds to a complementary sequence in the gene of interest.
  4. D) A nucleic acid probe is usually labeled with a radioactive isotope or fluorescent tag to help identify its location.

Answer:  A

Topic:  12.5

Skill:  Knowledge/Comprehension

Learning Outcome:  12.2

 

21) The type of recombinant bacteria most often used to mass-produce genes is

  1. A) Pseudomonas aeruginosa.
  2. B) Agrobacterium tumefaciens.
  3. C) Escherichia coli.
  4. D) Saccharomyces cerevisiae.

Answer:  C

Topic:  12.6

Skill:  Knowledge/Comprehension

Learning Outcome:  12.3

 

22) The only cells that can correctly attach sugars to proteins to form glycoprotein products are

  1. A) yeast cells.
  2. B) coli cells.
  3. C) mammalian cells.
  4. D) algal cells.

Answer:  C

Topic:  12.6

Skill:  Knowledge/Comprehension

Learning Outcome:  12.3

 

23) The advantage of being able to clone the gene for human insulin is that

  1. A) there are too few cows, pigs, and horses to provide an adequate supply of their insulin.
  2. B) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin.
  3. C) cow, pig, or horse insulin cannot keep a diabetic alive for more than three months.
  4. D) using human insulin increases the probability that, in the future, the person suffering from diabetes can be weaned from a dependence on insulin.

Answer:  B

Topic:  12.7

Skill:  Knowledge/Comprehension

Learning Outcome:  12.3

Global LO:  5

 

24) A vaccine works by

  1. A) inhibiting bacterial replication.
  2. B) stimulating the immune system.
  3. C) inhibiting viral replication.
  4. D) preventing the translation of mRNA.

Answer:  B

Topic:  12.7

Skill:  Knowledge/Comprehension

Learning Outcome:  12.3

Global LO:  5, 6

 

25) Which of the following statements about DNA technology is false?

  1. A) DNA technology is now used to mass-produce human insulin.
  2. B) DNA technology is now used to mass-produce human growth hormone.
  3. C) DNA technology is now used to create cells that can identify and kill cancer cells.
  4. D) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen.

Answer:  C

Topic:  12.7

Skill:  Knowledge/Comprehension

Learning Outcome:  12.3

Global LO:  5

 

26) Golden Rice is golden in color because it is rich in

  1. A) vitamin A.
  2. B) vitamin C.
  3. C) beta-carotene.
  4. D) chromium picolinate.

Answer:  C

Topic:  12.8

Skill:  Knowledge/Comprehension

Learning Outcome:  12.4

Global LO:  5

 

27) A transgenic animal is

  1. A) an animal that is the first of its kind to bear a particular allele.
  2. B) an animal in which a genetic defect has been corrected using recombinant DNA therapy.
  3. C) an animal containing a gene from another organism, typically of another species.
  4. D) an animal containing genes from three or more species.

Answer:  C

Topic:  12.8

Skill:  Knowledge/Comprehension

Learning Outcome:  12.4

Global LO:  5

 

28) Which of the following genetically modified organisms has not been developed by genetic engineers (at least, not yet)?

  1. A) transgenic rice with genes for milk proteins
  2. B) transgenic salmon with a growth hormone gene that allows them to grow more quickly
  3. C) transgenic corn with the gene for human insulin
  4. D) transgenic pigs with a roundworm gene that allows them to make more omega-3 fatty acids

Answer:  C

Topic:  12.8

Skill:  Knowledge/Comprehension

Learning Outcome:  12.4

Global LO:  5

 

29) Which of the following has not been a significant issue in the creation of genetically modified (GM) organisms?

  1. A) the fact that some plants carrying genes from other species might represent a threat to the environment
  2. B) the fact that GM organisms cannot be modified to prevent them from reproducing once they pass beyond the experimental stage
  3. C) the fact that rogue microbes might transfer dangerous genes into other organisms
  4. D) the fact that the protein products of transplanted genes might lead to allergic reactions

Answer:  B

Topic:  12.9

Skill:  Knowledge/Comprehension

Learning Outcome:  12.4

Global LO:  5

 

30) In order for gene therapy to be permanent in the patient being treated,

  1. A) the defective gene must first be removed from all somatic cells.
  2. B) the normal gene must be added to the germ line cells.
  3. C) the normal gene must first be treated with UV radiation to ensure noninfectivity.
  4. D) the normal gene must be transferred to somatic cells that can continuously multiply.

Answer:  D

Topic:  12.10

Skill:  Knowledge/Comprehension

Learning Outcome:  12.5

Global LO:  5

 

31) Genetically modifying ________ cells may directly affect future generations.

  1. A) bone marrow
  2. B) somatic
  3. C) gamete-forming
  4. D) photoreceptor

Answer:  C

Topic:  12.10

Skill:  Knowledge/Comprehension

Learning Outcome:  12.5

Global LO:  5

32) What is the preferred name of the technique used to determine if DNA comes from a particular individual?

  1. A) DNA technology
  2. B) DNA analysis
  3. C) DNA profiling
  4. D) DNA microarrays

Answer:  C

Topic:  12.11

Skill:  Knowledge/Comprehension

Learning Outcome:  12.6

Global LO:  5

 

33) If you commit a crime, you need to make sure that you do not leave even the smallest speck of blood, hair, or other organic matter from your body. If you do, the DNA in this material can be amplified by ________, subjected to genetic analysis, and used to identify you as the perpetrator of the crime.

  1. A) PCR
  2. B) STR analysis
  3. C) RFLP
  4. D) restriction digests

Answer:  A

Topic:  12.12

Skill:  Application/Analysis

Learning Outcome:  12.6, 12.7

Global LO:  2, 5

 

34) The polymerase chain reaction relies upon unusual, heat-resistant ________ that were isolated from bacteria living in hot springs.

  1. A) DNA polymerases
  2. B) phages
  3. C) restriction enzymes
  4. D) plasmids

Answer:  A

Topic:  12.12

Skill:  Knowledge/Comprehension

Learning Outcome:  12.7

Global LO:  6

 

35) Gel electrophoresis sorts DNA molecules on the basis of their

  1. A) nucleotide sequence.
  2. B) ability to bind to mRNA.
  3. C) solubility in the gel.
  4. D) size.

Answer:  D

Topic:  12.13

Skill:  Knowledge/Comprehension

Learning Outcome:  12.7

36) During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size.

  1. A) sample mixture
  2. B) positively charged electrode
  3. C) negatively charged electrode
  4. D) agarose gel

Answer:  D

Topic:  12.13

Skill:  Application/Analysis

Learning Outcome:  12.7

Global LO:  2

 

37) Which of the following statements regarding repetitive DNA is false?

  1. A) Repetitive DNA is usually found between genes.
  2. B) Repetitive DNA is identical in all humans.
  3. C) Repetitive DNA is usually repeated multiple times in the genome.
  4. D) Repetitive DNA can show great variation among individuals.

Answer:  B

Topic:  12.14

Skill:  Knowledge/Comprehension

Learning Outcome:  12.6

 

38) What is the current standard tool used for DNA profiling by forensic scientists?

  1. A) STR analysis
  2. B) gene cloning
  3. C) genetic engineering
  4. D) RFLP analysis

Answer:  A

Topic:  12.14

Skill:  Knowledge/Comprehension

Learning Outcome:  12.6

Global LO:  5

 

39) What is the smallest number of cells needed to perform a successful DNA profile?

  1. A) 1
  2. B) 20
  3. C) 200
  4. D) 1,000

Answer:  B

Topic:  12.15

Skill:  Knowledge/Comprehension

Learning Outcome:  12.6

Global LO:  5

 

40) Which of the following pieces of evidence would be considered the best for establishing biological relatedness?

  1. A) birth certificates
  2. B) pictures from family reunions
  3. C) testimony from relatives
  4. D) a very close match in the DNA profile

Answer:  D

Topic:  12.15

Skill:  Application/Analysis

Learning Outcome:  12.6

Global LO:  2, 5

 

41) When genetic variation in one nucleotide is found in at least 1% of the population, it is known as a

  1. A) single nucleotide polymorphism.
  2. B) short tandem repeat.
  3. C) recombinant DNA molecule.
  4. D) genomic library.

Answer:  A

Topic:  12.16

Skill:  Knowledge/Comprehension

Learning Outcome:  12.6

 

42) Which of the following statements about genome sequencing is false?

  1. A) The genomes of nearly 7,000 species have been completely sequenced.
  2. B) The first eukaryotic organism to have its genome sequenced was yeast.
  3. C) Most of the genomes that have been sequenced to date are eukaryotes.
  4. D) The genome of a mouse has been sequenced.

Answer:  C

Topic:  12.17

Skill:  Knowledge/Comprehension

Learning Outcome:  12.8

 

43) Which of the following statements about genomics is false?

  1. A) The first complete genome to be sequenced was a prokaryote.
  2. B) Whole sets of genes and their interactions are studied in the field of genomics.
  3. C) Genes from different species that have analogous sequences suggest similar function.
  4. D) DNA technology limits genomic studies to prokaryotes.

Answer:  D

Topic:  12.17

Skill:  Knowledge/Comprehension

Learning Outcome:  12.8

 

 

44) Approximately what percentage of human DNA is noncoding?

  1. A) 49%
  2. B) 79%
  3. C) 98.5%
  4. D) 99.9%

Answer:  C

Topic:  12.18

Skill:  Knowledge/Comprehension

Learning Outcome:  12.9

45) The type of repetitive DNA composed of sequences of large repeated units is often associated with

  1. A) tandem repeats.
  2. B) transposable elements.
  3. C) sex-linked genes.
  4. D) transcription factors.

Answer:  B

Topic:  12.18

Skill:  Knowledge/Comprehension

Learning Outcome:  12.9

 

46) Segments of eukaryotic DNA that can move or be copied from one site to another in the genome are called

  1. A) exons.
  2. B) plasmids.
  3. C) transposable elements.
  4. D) vectors.

Answer:  C

Topic:  12.18

Skill:  Knowledge/Comprehension

Learning Outcome:  12.9

 

47) Which of the following statements regarding DNA is false?

  1. A) Long stretches of repetitive DNA are prominent at centromeres and ends of chromosomes.
  2. B) Human and coli genomes contain approximately the same proportions of noncoding DNA.
  3. C) Current estimates are that there about 21,000 genes in the human genome.
  4. D) Telomeres seem to have a structural function.

Answer:  B

Topic:  12.18

Skill:  Knowledge/Comprehension

Learning Outcome:  12.9

 

 

48) Why is the whole-genome shotgun method currently the tool of choice for analyzing genomes?

  1. A) It is extremely accurate.
  2. B) Multiple genomes can be analyzed simultaneously.
  3. C) It is fast and inexpensive.
  4. D) It is very labor-intensive.

Answer:  C

Topic:  12.19

Skill:  Knowledge/Comprehension

Learning Outcome:  12.9

49) Which of the following statements regarding proteomics is true?

  1. A) Proteomics is the study of protein interaction within a cell.
  2. B) Proteomics involves the complete analysis of the prokaryotes.
  3. C) Proteomics is the systematic study of the full set of proteins encoded by a genome.
  4. D) Proteomics and genomics allow scientists to study life in an ever-increasing reductive approach.

Answer:  C

Topic:  12.20

Skill:  Knowledge/Comprehension

Learning Outcome:  12.8

 

50) The number of proteins in humans

  1. A) is approximately equal to the number of genes.
  2. B) cannot be determined because the human genome is too complex.
  3. C) is less than half the number of genes.
  4. D) is much greater than the number of genes.

Answer:  D

Topic:  12.20

Skill:  Knowledge/Comprehension

Learning Outcome:  12.8

 

51) Genome sequence analysis suggests that Neanderthals

  1. A) never interbred with humans.
  2. B) are more closely related to chimpanzees than humans.
  3. C) at least sometimes had pale skin and red hair.
  4. D) could not speak.

Answer:  C

Topic:  12.21

Skill:  Knowledge/Comprehension

Learning Outcome:  12.8

Global LO:  5

 

 

52) Approximately what percentage of the human genome is identical to that of a chimpanzee?

  1. A) 50.0%
  2. B) 62.3%
  3. C) 92.0%
  4. D) 98.8%

Answer:  D

Topic:  12.21

Skill:  Knowledge/Comprehension

Learning Outcome:  12.8

Global LO:  5

53) The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC

TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

  1. A) two
  2. B) three
  3. C) four
  4. D) five

Answer:  C

Topic:  12.2

Skill:  Application/Analysis

Learning Outcome:  12.1

Global LO:  2

 

54) Researchers are trying to make a genetically modified (GM) pig that expresses bovine (cow) growth hormone to make it grow bigger. They isolated the bovine growth hormone gene, cut it and a plasmid with the same restriction enzyme, and mixed them together. They inserted the mixture into pig zygotes, but only normal pigs, not GM pigs, grew. What did they likely do wrong?

  1. A) They are trying to make a GM animal, which is impossible.
  2. B) They forgot to add DNA ligase after mixing the plasmid and gene together.
  3. C) They should have used different restriction enzymes to cut the plasmid and the gene.
  4. D) They forgot to use PCR and make multiple copies of the growth hormone gene.

Answer:  B

Topic:  12.2, 12.8

Skill:  Application/Analysis

Learning Outcome:  12.1, 12.4

Global LO:  2

 

 

55) Which of the following is an example of a genetically modified organism but not a transgenic organism?

  1. A) Flavr Savr peaches (peaches that express larger quantities of a peach stability enzyme)
  2. B) Golden Rice (rice that expresses daffodil and bacteria beta-carotene synthesis enzymes)
  3. C) AquAdvantage salmon (Atlantic salmon that expresses Chinook salmon growth hormone)
  4. D) Roundup Ready soybeans (soybeans that express bacterial pesticide enzymes)

Answer:  A

Topic:  12.8

Skill:  Application/Analysis

Learning Outcome:  12.4

Global LO:  2, 5

56) You are setting up a PCR reaction and add a primer for one end of the target sequence, but you forget to add the primer for the other end of the target sequence. If you added the other necessary components, what do you expect to observe after running the PCR reaction for 40 cycles?

  1. A) The PCR reaction will produce billions of copies of the target DNA.
  2. B) The PCR reaction will produce millions of copies of the target DNA.
  3. C) The PCR reaction will produce one copy of the target DNA.
  4. D) The PCR reaction will produce zero copies of the target DNA.

Answer:  D

Topic:  12.12

Skill:  Synthesis/Evaluation

Learning Outcome:  12.7

Global LO:  2

 

57) Biotechnology companies sell kits that allow you to do PCR to amplify STR regions from human blood samples that you have collected. What components would you expect to find in the kit in order to be able to do successful PCR reactions?

  1. A) human DNA polymerase, primers that flank STR regions
  2. B) heat-stable DNA polymerase, primers that flank STR regions
  3. C) human DNA polymerase, primers that flank STR regions, free nucleotides
  4. D) heat-stable DNA polymerase, primers that flank STR regions, free nucleotides

Answer:  D

Topic:  12.12

Skill:  Application/Analysis

Learning Outcome:  12.7

Global LO:  2

 

 

58) TPOX is one of the STRs that is used to compare DNA between different people. Why is TPOX useful for comparing DNA between different people?

  1. A) TPOX varies in the number of repeats between different people.
  2. B) TPOX varies in sequence between different people.
  3. C) TPOX is only present in some people’s genomes.
  4. D) TPOX is present in different places in different people’s genomes.

Answer:  A

Topic:  12.11, 12.14

Skill:  Application/Analysis

Learning Outcome:  12.6

Global LO:  2

 

59) Cystic fibrosis is a genetic disease that results from a defective CFTR protein that alters ion flow through the cell membrane such that water does not cross the cell membrane. Gene therapy is being used to attempt to help cystic fibrosis patients. Which of the following steps is not needed to develop a gene therapy treatment for cystic fibrosis?

  1. A) Clone the normal-functioning CFTR gene and make an RNA version of the gene.
  2. B) Make antibodies to the defective CFTR protein to enhance the patient’s immune system.
  3. C) Remove cells from a patient and infect them with the recombinant virus.
  4. D) Insert the RNA version of the CFTR gene into a virus.

Answer:  B

Topic:  12.10

Skill:  Application/Analysis

Learning Outcome:  12.5

Global LO:  2, 5

60) When cloning a gene, one of the steps is to use restriction enzymes to insert the gene of interest into a vector. If you separated the empty vector (the vector without the gene of interest) and the cloned vector (the vector that has the gene of interest added) using agarose gel electrophoresis, what do you expect to observe on the agarose gel if both vectors are loaded at the same position at the top of the gel?

  1. A) The empty vector would migrate farther down than the cloned vector.
  2. B) The cloned vector would migrate farther down than the cloned vector.
  3. C) The empty vector would migrate the same distance as the cloned vector.
  4. D) It is impossible to know without knowing the identity of the gene of interest.

Answer:  A

Topic:  12.1, 12.13

Skill:  Synthesis/Evaluation

Learning Outcome:  12.7

Global LO:  2, 4

 

 

61) Which of the following is an example of a transgenic organism?

  1. A) a fern grown from a single fern root cell
  2. B) a rat with rabbit hemoglobin genes
  3. C) a cow that has been fed pig growth hormone in its food
  4. D) a human given a corrected human blood-clotting gene

Answer:  B

Topic:  12.8

Skill:  Application/Analysis

Learning Outcome:  12.4

Global LO:  2

 

62) The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI?

  1. A) two
  2. B) three
  3. C) four
  4. D) five

Answer:  C

Topic:  12.2

Skill:  Application/Analysis

Learning Outcome:  12.1

Global LO:  2

 

63) When DNA molecule “A” is cut with the restriction enzyme EcoRI, it is cut into four pieces. When DNA molecule “B,” which is exactly identical to DNA molecule “A” except for the presence of one SNP, is cut with EcoRI, it is cut into three pieces. What is the best explanation for this observation?

  1. A) The SNP occurs in all EcoRI restriction sites in DNA molecule “B.”
  2. B) The SNP occurs in a single EcoRI restriction site in DNA molecule “B.”
  3. C) Not enough EcoRI was used to cut DNA molecule “B.”
  4. D) An excess of EcoRI was used to cut DNA molecule “A.”

Answer:  B

Topic:  12.2, 12.16

Skill:  Application/Analysis

Learning Outcome:  12.1, 12.6

Global LO:  2

 

64) Some restriction enzymes do not leave sticky ends when cutting DNA molecules; rather, they cut a restriction site down the middle and leave “blunt-ended” DNA molecules, which do not have any single-stranded nucleotide extensions. Which of the following is not a likely outcome when trying to insert a gene into a plasmid when have both been cut with the same “blunt-ended” restriction enzyme?

  1. A) The gene might be inserted into the plasmid by forming hydrogen bonds.
  2. B) The gene might be inserted into the plasmid multiple times in a row.
  3. C) The gene might insert into the plasmid in the proper (forward) orientation.
  4. D) The gene might insert into the plasmid in the wrong (backward) orientation.

Answer:  A

Topic:  12.1, 12.2

Skill:  Synthesis/Evaluation

Learning Outcome:  12.1

Global LO:  2

 

65) You prepare a genomic library and use this as a source to produce recombinant proteins in E. coli. However, after producing the proteins you find that they are all too long or too short. In fact, you don’t find a single protein that is the correct size. What is the best explanation for this result?

  1. A) Since a genomic library was used as the source of the genes, the introns were included during transcription and translation.
  2. B) Since bacteria were used to produce the proteins, sugar groups were not properly added on to the proteins that were being made.
  3. C) Since a genomic library was used as the source, the recombinant bacterial plasmid DNA was likely incorporated into the proteins being made.
  4. D) Since bacteria were used to produce the proteins, the native bacterial plasmid DNA was likely incorporated into the proteins being made.

Answer:  A

Topic:  12.3, 12.4, 12.6

Skill:  Application/Analysis

Learning Outcome:  12.2, 12.3

Global LO:  2

 

66) You are trying to produce a cDNA library starting from mRNA in skeletal muscle cells. You add the following components to a tube and let the reaction proceed: skeletal muscle mRNA, free nucleotides, and DNA polymerase. After inspecting the products of the reaction, you do not find any cDNA molecules at all. What is the most likely explanation for this result?

  1. A) You used mRNA instead of genomic DNA as the source material.
  2. B) You used DNA polymerase instead of reverse transcriptase.
  3. C) cDNA libraries can only be made from skin cell mRNA molecules.
  4. D) You forgot to add a radiolabeled nucleic acid probe to the tube.

Answer:  B

Topic:  12.4

Skill:  Application/Analysis

Learning Outcome:  12.2

Global LO:  2

67) Gel electrophoresis is normally set up with the negative electrode at the top of the gel and the positive electrode at the bottom of the gel. The DNA products are loaded at the top of the gel, and then a current is applied to separate them. However, when preparing to run a gel, you accidentally switched the locations of the negative and positive electrodes such that the positive electrode is at the top and the negative electrode is at the bottom. You still loaded the DNA products at the top of the gel as normal. What result are you most likely to observe if you apply an electric current to this gel setup?

  1. A) All DNA molecules will migrate up the gel toward the positive electrode.
  2. B) All DNA molecules will migrate down the gel toward the negative electrode.
  3. C) Shorter DNA molecules will move up the gel, and longer DNA molecules will move down the gel.
  4. D) Longer DNA molecules will move up the gel, and shorter DNA molecules will move down the gel.

Answer:  A

Topic:  12.3, 12.4, 12.6

Skill:  Application/Analysis

Learning Outcome:  12.2, 12.3

Global LO:  2

 

12.2   Art Questions

 

1) Which step in this process requires use of restriction enzymes?

 

  1. A) step A
  2. B) step B
  3. C) step C
  4. D) step D

Answer:  B

Topic:  12.1

Skill:  Application/Analysis

Learning Outcome:  12.1

Global LO:  2, 3

 

2) Which step in the creation of cDNA involves the use of reverse transcriptase?

 

 

  1. A) step 1
  2. B) step 2
  3. C) step 3
  4. D) step 4

Answer:  C

Topic:  12.4

Skill:  Application/Analysis

Learning Outcome:  12.2

Global LO:  2, 3

 

3) Use the figure below to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top.

Approximately how many bases are in the DNA molecule that the arrow is pointing to?

 

 

 

  1. A) 30 bases
  2. B) 36 bases
  3. C) 40 bases
  4. D) 44 bases

Answer:  B

Topic:  12.13

Skill:  Application/Analysis

Learning Outcome:  12.7

Global LO:  2, 3

 

4) Use the figure below to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. CS, crime scene; S1, suspect 1; S2, suspect 2; S3, suspect 3.

Which suspect is likely to have committed the crime?

 

 

 

  1. A) suspect 1
  2. B) suspect 2
  3. C) suspect 3
  4. D) suspect 1 or 2

Answer:  C

Topic:  12.11, 12.14

Skill:  Application/Analysis

Learning Outcome:  12.6

Global LO:  2, 3, 5

 

5) Below is a figure depicting the whole-genome shotgun method. Which step is most similar to a step used when preparing a genomic library?

 

 

  1. A) step 1
  2. B) step 2
  3. C) step 3
  4. D) step 4

Answer:  A

Topic:  12.3, 12.19

Skill:  Application/Analysis

Learning Outcome:  12.2, 12.9

Global LO:  2, 3

 

12.3   Scenario Questions

 

After reading the paragraph below, answer the questions that follow.

 

Four decades after the end of the Vietnam War, the remains of an Air Force pilot were discovered and returned to the United States. A search of Air Force records identified three families to which the remains might possibly belong. Each family had a surviving twin of a missing service member. The following STR profiles were obtained from the remains of the pilot and the surviving twins from the three families.

 

 

 

 

1) In order to match the pilot’s remains to the correct family using DNA profiling,

  1. A) the majority of the STR bands must match.
  2. B) each of the 13 STR bands must match.
  3. C) the bands for site 13 must match.
  4. D) bands 5 and 7 must match.

Answer:  B

Topic:  12.11, 12.12, 12.13, 12.14, 12.15

Skill:  Knowledge/Comprehension

Learning Outcome:  12.6

Global LO:  2, 3, 5

 

2) Based on analysis of the STR sites shown, does the missing pilot belong to any of these three families?

  1. A) No, none of the families match.
  2. B) Yes, family 1 matches.
  3. C) Yes, family 2 matches.
  4. D) Yes, family 3 matches.

Answer:  D

Topic:  12.11, 12.12, 12.13, 12.14, 12.15

Skill:  Application/Analysis

Learning Outcome:  12.6

Global LO:  2, 3

 

3) Based on analysis of the STR sites shown, which family is the missing pilot least likely to belong to?

  1. A) family 1
  2. B) family 2
  3. C) family 3
  4. D) Family 1 and family 2 are equally unlikely.

Answer:  D

Topic:  12.11, 12.12, 12.13, 12.14, 12.15

Skill:  Application/Analysis

Learning Outcome:  12.6

Global LO:  2, 3


After reading the paragraphs below, answer the questions that follow.

 

Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing and frequent lung infections.

 

Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death).

 

4) If you wanted to produce a recombinant form of DNase I, what cell type should you use?

  1. A) coli
  2. B) yeast
  3. C) mammalian
  4. D) plant

Answer:  C

Topic:  12.6

Skill:  Application/Analysis

Learning Outcome:  12.3

Global LO:  2, 5

 

5) If recombinant DNase I is added to a vial of respiratory secretions from a cystic fibrosis patient, which of the following results would indicate that the recombinant DNase I is functional?

  1. A) The secretions become thicker and more viscous.
  2. B) The secretions become less viscous.
  3. C) There is no effect on the secretions.
  4. D) This experiment could not tell you if the DNase was functional or not.

Answer:  B

Topic:  12.6

Skill:  Synthesis/Evaluation

Learning Outcome:  12.3

Global LO:  1, 2, 5

 

6) A scientist produced a batch of recombinant DNase I in E. coli cells and a batch in mammalian cells. She placed 0.1 mg of the E. coli-derived DNase I in a vial containing a solution of DNA, and she placed 0.1 mg of the mammalian cell-derived DNase I in a separate vial containing the same solution of DNA. The initial viscosity of the DNA solutions was identical. What do you expect the viscosity of the DNA solutions to be after ten minutes have passed, and why?

  1. A) The viscosity of the mammalian cell DNase I vial will be lower than that of the coli DNase I vial because the mammalian cell DNase I will be functional and able to degrade the DNA.
  2. B) The viscosity of the mammalian cell DNase I vial will be higher than that of the coli DNase I vial because the mammalian cell DNase I will be functional and able to degrade the DNA.
  3. C) The viscosity of the coli DNase I vial will be lower than that of the mammalian cell DNase I vial because the E. coli DNase I will be functional and able to degrade the DNA.
  4. D) The viscosity of the coli DNase I vial will be higher than that of the mammalian cell DNase I vial because the E. coli DNase I will be functional and able to degrade the DNA.

Answer:  B

Topic:  12.6

Skill:  Synthesis/Evaluation

Learning Outcome:  12.3

Global LO:  1, 2, 5

 

Campbell Biology: Concepts and Connections, 8e (Reece et al.)

Chapter 24   The Immune System

 

24.1   Multiple-Choice Questions

 

1) The body’s innate defenses against infection include

  1. A) several specific antibodies.
  2. B) barriers such as dead skin cells and mucus.
  3. C) increased production of certain hormones and changes in microcirculation.
  4. D) memory cells.

Answer:  B

Topic:  24.1

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

2) Which of the following are found in the interstitial fluid and consume any bacteria and virus-infected cells they encounter?

  1. A) erythrocytes
  2. B) leukocytes
  3. C) macrophages
  4. D) interferons

Answer:  C

Topic:  24.1

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

3) Natural killer cells

  1. A) are phagocytes that attack and kill pathogenic microorganisms.
  2. B) attack virus-infected cells by releasing chemicals that lead to cell death.
  3. C) tag pathogenic microorganisms with antibodies.
  4. D) “eat” microorganisms that have been tagged with antibodies.

Answer:  B

Topic:  24.1

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

4) Virus-infected cells produce ________, proteins that help neighboring cells fight further viral infections.

  1. A) lysozymes
  2. B) interferons
  3. C) histamines
  4. D) interleukin-2

Answer:  B

Topic:  24.1

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

5) A researcher who detects a higher-than-normal amount of interferon in a laboratory rat would correctly conclude that

  1. A) the rat has, or recently had, a viral infection.
  2. B) cancerous cells are present in the rat.
  3. C) the rat’s diet is deficient in calcium.
  4. D) monocytes are differentiating into macrophages in the rat’s bloodstream.

Answer:  A

Topic:  24.1

Skill:  Application/Analysis

Learning Outcome:  24.1

Global LO:  2

 

6) Some complement proteins

  1. A) induce antibody formation by phagocytic cells.
  2. B) help trigger the inflammatory response.
  3. C) are released by natural killer cells to attack cancer and virus-infected cells.
  4. D) replace T cells in the cell-mediated response.

Answer:  B

Topic:  24.1

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

7) Which of the following helps activate our nonspecific (innate) defense system?

  1. A) active immunity
  2. B) inflammation
  3. C) passive immunity
  4. D) mobilization of erythrocytes

Answer:  B

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

8) When you cut yourself, the damaged cells immediately release chemical alarm signals, such as

  1. A) interferon.
  2. B) complement.
  3. C) histamine.
  4. D) antihistamine.

Answer:  C

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

 

9) Which of the following is an immediate effect of histamine release?

  1. A) dilation of local blood vessels
  2. B) blocking of a response to ragweed pollen
  3. C) conversion of histamine to histidine
  4. D) increase in blood pressure

Answer:  A

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

10) The main function of the inflammatory response is to

  1. A) initiate the production of antibodies.
  2. B) remove contaminating microorganisms and initiate repair of damaged tissues.
  3. C) initiate T cell-mediated immune responses.
  4. D) initiate the production of killer cells.

Answer:  B

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

11) Bacterial infections can cause a serious, potentially fatal systemic inflammatory response called

  1. A) anaphylaxis.
  2. B) pelvic inflammatory disease.
  3. C) septic shock.
  4. D) pneumonia.

Answer:  C

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

12) The human lymphatic system consists of all of the following structures except the

  1. A) thymus.
  2. B) tonsils.
  3. C) spleen.
  4. D) pancreas.

Answer:  D

Topic:  24.4

Skill:  Knowledge/Comprehension

Learning Outcome:  24.3

 

 

13) The two main functions of the lymphatic system are

  1. A) coagulating blood and fighting infections.
  2. B) producing hormones that regulate the immune system and coagulating blood.
  3. C) producing hormones that regulate the immune system and fighting infections.
  4. D) returning tissue fluid to the circulatory system and fighting infections.

Answer:  D

Topic:  24.4

Skill:  Knowledge/Comprehension

Learning Outcome:  24.3

 

14) A molecule that can elicit an adaptive immune response is called

  1. A) a complement.
  2. B) an interferon.
  3. C) an antibody.
  4. D) an antigen.

Answer:  D

Topic:  24.3

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

15) Antibodies are

  1. A) amino acids.
  2. B) lipids.
  3. C) carbohydrates.
  4. D) proteins.

Answer:  D

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.3

 

16) One kind of vaccine consists of

  1. A) buffered antibodies.
  2. B) B cells.
  3. C) a harmless variant strain of a disease-causing microbe.
  4. D) antibiotics.

Answer:  C

Topic:  24.2

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

Global LO:  5

 

 

17) Which of the following diseases cannot currently be prevented by vaccination?

  1. A) AIDS
  2. B) polio
  3. C) measles
  4. D) tetanus

Answer:  A

Topic:  24.14, 24.15

Skill:  Knowledge/Comprehension

Learning Outcome:  24.8

Global LO:  5

 

18) The transfer of antibodies in breast milk to an infant is an example of ________ immunity.

  1. A) nonspecific
  2. B) passive
  3. C) humoral
  4. D) active

Answer:  B

Topic:  24.3

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

 

19) Upon which of the following is passive immunity dependent?

  1. A) a person’s own immune system producing antibodies
  2. B) antibodies made by another organism
  3. C) antibody-producing cells from another organism
  4. D) antigens from a person’s own body

Answer:  B

Topic:  24.3

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

20) Which of the following cell types is responsible for the humoral immune response?

  1. A) B cells
  2. B) neutrophils
  3. C) natural killer cells
  4. D) macrophages

Answer:  A

Topic:  24.5

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

 

 

21) Which of the following statements about the humoral immune response is true?

  1. A) The humoral immune response defends against bacteria and viruses by activating T cells.
  2. B) The humoral immune response defends primarily against bacteria and viruses present in body fluids.
  3. C) The humoral immune response plays a major role in protecting the body from cancerous cells.
  4. D) The humoral immune response is the result of macrophages producing antibodies.

Answer:  B

Topic:  24.5

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

 

22) Which of the following cell types is responsible for the cell-mediated immune response?

  1. A) T cells
  2. B) B cells
  3. C) leukocytes
  4. D) red blood cells

Answer:  A

Topic:  24.5

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

 

23) The adaptive immune system is capable of mounting specific responses to particular microorganisms because

  1. A) lymphocytes are able to change their antigen specificity as required to fight infection.
  2. B) stem cells determine which type of B and T cells to make.
  3. C) the body contains an enormous diversity of lymphocytes, each with the ability to respond to a different antigen.
  4. D) stem cells make different antigen receptors depending on the invading microorganism.

Answer:  C

Topic:  24.5

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

24) Which of the following statements regarding antigens and antibodies is false?

  1. A) An antibody usually recognizes and binds to an antigenic determinant.
  2. B) A single antigen may stimulate the immune system to make several distinct antibodies to it.
  3. C) Most antigens are proteins or large polysaccharides on the surfaces of viruses or foreign cells.
  4. D) Each antibody has only one antigen-binding site.

Answer:  D

Topic:  24.6

Skill:  Knowledge/Comprehension

Learning Outcome:  24.5

 

 

25) A primary immune response is

  1. A) the immune response elicited by the primary antigen of a disease-causing microorganism.
  2. B) the immune response elicited by the primary antibodies of a disease-causing microorganism.
  3. C) the immune response elicited by the first exposure of lymphocytes to a particular antigen.
  4. D) the immune response elicited by the first exposure of memory cells to a particular antigen.

Answer:  C

Topic:  24.8

Skill:  Knowledge/Comprehension

Learning Outcome:  24.4

 

26) Clonal selection

  1. A) determines the pool of mature leukocytes that will be stimulated by macrophages.
  2. B) requires the activation of natural killer cells.
  3. C) describes the proliferation of B and T lymphocytes after they have been activated by an antigen.
  4. D) requires the presence and activation of complement.

Answer:  C

Topic:  24.7

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

 

27) When a B cell first interacts with its particular antigen, the B cell

  1. A) dies after destroying the antigen.
  2. B) engulfs the antigen and digests it.
  3. C) differentiates and develops into a clone of antibody-producing effector cells.
  4. D) alters the chemical configuration of the antigen.

Answer:  C

Topic:  24.7

Skill:  Knowledge/Comprehension

Learning Outcome:  24.2

28) Which of the following choices best describes a plasma cell?

  1. A) It is a differentiated T cell.
  2. B) It is a differentiated B cell.
  3. C) It responds to an antigen and differentiates into a B cell.
  4. D) It is produced during a primary immune response, persists, and multiplies in response to a reappearance of the antigen.

Answer:  B

Topic:  24.18

Skill:  Knowledge/Comprehension

Learning Outcome:  24.7

 

 

29) The secondary immune response occurs when memory cells are activated by a second exposure to

  1. A) hormones.
  2. B) antibodies.
  3. C) antigens.
  4. D) plasma cells.

Answer:  C

Topic:  24.8

Skill:  Knowledge/Comprehension

Learning Outcome:  24.4

 

30) Which of the following distinguishes the secondary immune response from the primary immune response?

  1. A) The primary response is specific; the secondary one is not.
  2. B) The secondary response is faster and stronger.
  3. C) The primary response involves B cells; the secondary one involves T cells.
  4. D) The secondary response allows additional antigens to be recognized faster.

Answer:  B

Topic:  24.8

Skill:  Knowledge/Comprehension

Learning Outcome:  24.4

 

31) While hiking, you must push aside thick branches that are near your face. One of them rips the skin on your arm and you begin to bleed from the cut. Which of the following plays an important role in initially protecting you from infection?

  1. A) nonspecific antibodies
  2. B) barriers such as dead skin cells and mucus because they are part of the innate immune system
  3. C) increased production of certain hormones and changes in microcirculation
  4. D) memory cells because they are part of the adaptive immune system

Answer:  B

Topic:  24.1

Skill:  Application/Analysis

Learning Outcome:  24.1

Global LO:  2

32) Antibody molecules may function by causing the

  1. A) destruction of complement proteins.
  2. B) agglutination of viruses or bacteria.
  3. C) solubilization of viruses or bacteria.
  4. D) crystallization of antigenic particles.

Answer:  B

Topic:  24.9

Skill:  Knowledge/Comprehension

Learning Outcome:  24.6

 

 

33) The complement system can be activated by

  1. A) inflammatory mediators.
  2. B) antigen-antibody complexes.
  3. C) B cell plasma membrane.
  4. D) T cells.

Answer:  B

Topic:  24.9

Skill:  Knowledge/Comprehension

Learning Outcome:  24.6

 

34) ________ rely completely on innate immunity.

  1. A) Giraffes
  2. B) Dogs
  3. C) Humans
  4. D) Beetles

Answer:  D

Topic:  24.1

Skill:  Application/Analysis

Learning Outcome:  24.1

Global LO:  2, 6

 

35) Complement proteins can do all of the following except

  1. A) enhance phagocytosis by innate immune cells by attaching to cell invaders.
  2. B) help trigger the inflammatory response.
  3. C) attack cancer and virus-infected cells after they are released by natural killer cells.
  4. D) act as chemical signals to recruit more immune cells to the site of infection.

Answer:  C

Topic:  24.1

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

36) The basic function of activated T cells is to battle

  1. A) pathogens in blood or lymph.
  2. B) pathogens in interstitial fluid.
  3. C) pathogens that have already entered body cells.
  4. D) chemical mediators of immunity.

Answer:  C

Topic:  24.12

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

37) When an antigen-presenting cell interacts successfully with a helper T cell, the antigen-presenting cell secretes a signal molecule that assists in the activation of the helper T cell. This signal molecule is

  1. A) interferon.
  2. B) complement.
  3. C) interleukin-1.
  4. D) perforin.

Answer:  C

Topic:  24.12

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

38) What type of cell helps to stimulate B cells to produce antibodies?

  1. A) plasma cell
  2. B) cytotoxic T cell
  3. C) helper T cell
  4. D) macrophage

Answer:  C

Topic:  24.12

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

39) Which of the following is an effect of interleukin-2?

  1. A) stimulating helper T cells to divide
  2. B) stimulating mast cells to release histamine
  3. C) stimulating antigen-presenting cells
  4. D) modulating macrophage phagocytosis

Answer:  A

Topic:  24.12

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

40) After binding to an infected cell, the cytotoxic T cell

  1. A) releases interleukin-1.
  2. B) becomes a phagocytic cell.
  3. C) neutralizes the infecting bacteria or viruses.
  4. D) releases a protein called perforin.

Answer:  D

Topic:  24.13

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

 

41) ________ can destroy infected cells.

  1. A) Macrophages
  2. B) Plasma cells
  3. C) B cells
  4. D) Cytotoxic T cells

Answer:  D

Topic:  24.13

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

42) Which of the following statements about HIV is false?

  1. A) The genome of HIV consists of RNA.
  2. B) HIV attacks mast cells.
  3. C) HIV replicates inside helper T cells.
  4. D) Some drugs have proven effective in combating the spread of HIV from mothers to their children.

Answer:  B

Topic:  24.14

Skill:  Knowledge/Comprehension

Learning Outcome:  24.8

 

43) Which of the following types of cells does HIV preferentially infect?

  1. A) cytotoxic T cells
  2. B) natural killer cells
  3. C) helper T cells
  4. D) memory cells

Answer:  C

Topic:  24.14

Skill:  Knowledge/Comprehension

Learning Outcome:  24.8

 

44) Which of the following statements about AIDS is true?

  1. A) The AIDS vaccine can prevent the spread of HIV.
  2. B) There is now a treatment for AIDS that is simple and effective.
  3. C) Using condoms during sex prevents the spread of the virus that causes AIDS.
  4. D) AIDS patients live no longer than two to three years.

Answer:  C

Topic:  24.14

Skill:  Knowledge/Comprehension

Learning Outcome:  24.8

Global LO:  5

 

 

45) HIV is a virus that is particularly difficult to eradicate

  1. A) because of its DNA genome.
  2. B) because it rarely mutates.
  3. C) because it mutates to produce new drug-resistant strains.
  4. D) due to its small size.

Answer:  C

Topic:  24.15

Skill:  Knowledge/Comprehension

Learning Outcome:  24.8

Global LO:  5

46) While playing soccer in your backyard, you disrupt a small fire ant mound. The fire ants emerge and bite your feet. Your feet begin to show swollen, raised areas around the bites. What is happening?

  1. A) Your innate internal defenses have been activated.
  2. B) Your adaptive defenses have been activated.
  3. C) Blood flow to the affected area decreases.
  4. D) You are experiencing passive immunity.

Answer:  A

Topic:  24.2

Skill:  Application/Analysis

Learning Outcome:  24.1

Global LO:  2

 

47) ________ genes are responsible for coding for self-proteins.

  1. A) STR
  2. B) MHC
  3. C) RFLP
  4. D) PCR

Answer:  B

Topic:  24.16

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

48) Which of the following diseases is thought to be an autoimmune disease?

  1. A) cancer of the bone marrow
  2. B) insulin-dependent diabetes mellitus
  3. C) measles and mumps
  4. D) duodenal ulcer

Answer:  B

Topic:  24.17

Skill:  Knowledge/Comprehension

Learning Outcome:  24.7

 

 

49) What type of immune response is always disadvantageous to a person?

  1. A) inflammatory
  2. B) humoral
  3. C) autoimmune
  4. D) complement-mediated

Answer:  C

Topic:  24.17

Skill:  Knowledge/Comprehension

Learning Outcome:  24.7

 

50) Which of the following compounds is produced and secreted by mast cells during an allergic reaction?

  1. A) interferon
  2. B) allergens
  3. C) histamine
  4. D) perforin

Answer:  C

Topic:  24.18

Skill:  Knowledge/Comprehension

Learning Outcome:  24.7

51) Anaphylactic shock is an example of an

  1. A) autoimmune disease.
  2. B) immunodeficiency disease.
  3. C) allergic response.
  4. D) acquired autoimmune disease.

Answer:  C

Topic:  24.18

Skill:  Knowledge/Comprehension

Learning Outcome:  24.7

 

52) Mononucleosis (“mono”) is usually caused by EBV, or the Epstein-Barr virus. Mono is more common in children than in adults because adults usually have developed ________ toward the virus.

  1. A) innate immunity
  2. B) adaptive immunity
  3. C) lymphocytes
  4. D) passive immunity

Answer:  B

Topic:  24.3

Skill:  Application/Analysis

Learning Outcome:  24.2

Global LO:  2, 5

 

 

53) When mothers transmit IgG to their developing child during gestation, such as in the case of a tetanus antibody, the mothers are providing a form of _________ immunity.

  1. A) nonspecific
  2. B) passive
  3. C) humoral
  4. D) active

Answer:  B

Topic:  24.3

Skill:  Application/Analysis

Learning Outcome:  24.2

Global LO:  2, 5

 

54) Which is the correct order of steps taken by B and T cells to defend against infection in body fluids and cells?

  1. B and T cells move to the lymph nodes, spleen, and other parts of the lymphatic system.
  2. B and T cells leave the bone marrow and thymus and move to the bloodstream.
  3. B and T cells meet and begin to fight viruses or other infectious agents.
  4. B and T cells develop antigen receptors.
  5. A) 4, 2, 1, 3
  6. B) 2, 4, 3, 1
  7. C) 4, 3, 2, 1
  8. D) 2, 4, 1, 3

Answer:  A

Topic:  24.5

Skill:  Synthesis/Evaluation

Learning Outcome:  24.2

Global LO:  2

55) Antigens can be

  1. A) proteins.
  2. B) large polysaccharides that protrude from virus surfaces or foreign cells.
  3. C) blood or tissue cells from organisms of the same or different species.
  4. D) all of the above.

Answer:  D

Topic:  24.6

Skill:  Knowledge/Comprehension

Learning Outcome:  24.4

 

 

56) Enzymes are to active sites as

  1. A) antigenic binding sites are to antigenic determinants.
  2. B) viruses are to antigens.
  3. C) antigens are to epitopes.
  4. D) antigenic determinants are to epitopes.

Answer:  C

Topic:  24.6

Skill:  Application/Analysis

Learning Outcome:  24.5

Global LO:  2

 

57) A physician sees a new patient who is 25 years old. The patient reports that she has been experiencing recurrent ear, nose, and throat infections since she was about 5 years old. The infections last for long periods of time and are difficult to treat. The physician suspects that the patient may have

  1. A) an autoimmune disorder.
  2. B) an allergic reaction.
  3. C) an immunodeficiency disorder.
  4. D) abnormal levels of allergens.

Answer:  C

Topic:  24.17

Skill:  Application/Analysis

Learning Outcome:  24.7

Global LO:  2, 5

 

58) Bronchitis can be easily acquired by individuals with immunodeficiency disorders. In these situations, bronchitis is an example of

  1. A) a virus.
  2. B) an opportunistic infection.
  3. C) adaptive immunity.
  4. D) an autoimmune disorder.

Answer:  B

Topic:  24.14

Skill:  Application/Analysis

Learning Outcome:  24.8

Global LO:  2, 5

 

59) In May 2013, a drug-resistant strain of H7N9 bird flu was discovered in China. The implication(s) of a drug-resistant virus strain is(are)

  1. A) that it will be difficult to eradicate.
  2. B) that it could proliferate quickly.
  3. C) that it should be studied carefully.
  4. D) all of the above.

Answer:  D

Topic:  24.15

Skill:  Application/Analysis

Learning Outcome:  24.8

Global LO:  2, 5

 

60) Spring has arrived, and you notice your neighbors are cutting their grass. When you walk outside to check if your mail has arrived, your eyes begin to water and feel itchy. You are more than likely experiencing

  1. A) an overreaction to pollen.
  2. B) a reaction due to an autoimmune disease.
  3. C) a pollen allergy.
  4. D) both A and C.

Answer:  D

Topic:  24.18

Skill:  Knowledge/Comprehension

Learning Outcome:  24.7

 

61) Because cytotoxic T cells can recognize viral proteins, they can destroy these infected cells. This is particularly important to individuals with certain kinds of cancers because

  1. A) destroying the infected cells can help slow the spread of the infected cells.
  2. B) destroying the infected cells can help stop the spread of the infected cells.
  3. C) destroying the infected cells will help prevent future infections of other viruses.
  4. D) both A and B.

Answer:  D

Topic:  24.13

Skill:  Knowledge/Comprehension

Learning Outcome:  24.9

 

62) A physician is trying to determine if a patient has functioning helper T cells. Which of the following events would provide evidence that helper T cells are acting normally?

  1. A) Antibodies recognize and bind to antigens.
  2. B) Memory cells are produced after the secondary immune response.
  3. C) Stimulatory proteins are secreted that help activate B cells, thus stimulating the humoral immune response.
  4. D) The inflammatory response is triggered.

Answer:  C

Topic:  24.12

Skill:  Synthesis/Evaluation

Learning Outcome:  24.9

Global LO:  2, 5

63) A woman sustains irreversible damage to one of her lungs in a fire. Her identical twin sister, who lives in another state, offers to donate one of her lungs to her injured sibling. Would physicians view this as an organ transplant surgery with a strong chance of success?

  1. A) Yes; the identical twins would have highly similar self-proteins, and this would likely minimize rejection by cytotoxic T cells.
  2. B) Yes; the identical twins would have highly different self-proteins, and this would likely minimize rejection by cytotoxic T cells.
  3. C) No; the identical twins would have highly similar self-proteins, and this would likely minimize rejection by cytotoxic T cells.
  4. D) No; the identical twins would have highly different self-proteins, and this would likely minimize rejection by cytotoxic T cells.

Answer:  A

Topic:  24.16

Skill:  Application/Analysis

Learning Outcome:  24.9

Global LO:  2, 5

 

64) Most _________ are located at specific areas where bacteria microbes tend to attack so that they can readily engulf and destroy the invading bacteria.

  1. A) erythrocytes
  2. B) leukocytes
  3. C) macrophages
  4. D) interferons

Answer:  C

Topic:  24.1

Skill:  Application/Analysis

Learning Outcome:  24.1

Global LO:  24.2

 

65) ________ are a component of the immune system that are able to destroy cancer cells by deploying toxins into infected cells as a means of killing them. In this role they are cytotoxic—that is, “cell killing.”

  1. A) Natural killer cells
  2. B) Phagocytes
  3. C) Antibodies
  4. D) B cells

Answer:  A

Topic:  24.1, 24.2, 24.3

Skill:  Knowledge/Comprehension

Learning Outcome:  24.1

 

66) Innate defenses are described in the text as “always standing by, ready to be used in their current form.” Which of the following are examples of innate immunity?

  1. stomach pH
  2. natural killer cells
  3. B lymphocytes
  4. fever
  5. A) 1, 2
  6. B) 2, 3, 4
  7. C) 1, 3, 4
  8. D) 1, 2, 4

Answer:  D

Topic:  24.1, 24.2, 24.3

Skill:  Application/Analysis

Learning Outcome:  24.1

Global LO:  2

 

67) You have been running a high fever, have stomach cramps, and have felt weak and disoriented for five days, so you set up an appointment with your physician. After asking you a few questions, she starts a physical examination by probing for swollen areas in your abdomen. You immediately sense that she is looking for

  1. A) lymph nodes.
  2. B) histamines.
  3. C) antibodies.
  4. D) antigens.

Answer:  A

Topic:  24.4

Skill:  Application/Analysis

Learning Outcome:  24.3

Global LO:  2, 3

 

68) A physician diagnoses a patient with a bacterial infection and determines that the patient is not immune to the bacteria. He delivers a shot of blood plasma that contains antibodies to his patient. The physician is transferring

  1. A) lymph nodes.
  2. B) the cell-mediated immune response.
  3. C) antigen receptors.
  4. D) the humoral immune response.

Answer:  D

Topic:  24.5

Skill:  Application/Analysis

Learning Outcome:  24.2

Global LO:  2

 

69) Which of the following are antigens?

  1. toxins
  2. chemicals
  3. foreign particles (e.g., splinters)
  4. drugs
  5. A) 1, 2, 3
  6. B) 2, 3
  7. C) 1, 4
  8. D) 1, 2, 3, 4

Answer:  D

Topic:  24.2

Skill:  Application/Analysis

Learning Outcome:  24.2

Global LO:  2

 

70) Which of the following describes a complete defense system?

  1. A) antibodies of the adaptive humoral immune response and interferons
  2. B) antibodies of the adaptive humoral immune response and components of innate immunity
  3. C) phagocytosis only
  4. D) complement system only

Answer:  B

Topic:  24.9

Skill:  Application/Analysis

Learning Outcome:  24.6

Global LO:  2

 

71) Monoclonal antibodies are a successful driving force of therapy in the treatment of asthma. The use of antibodies to treat asthma is an application of

  1. A) ecological research on human populations affected by asthma.
  2. B) medical research in a laboratory setting.
  3. C) field research in a natural setting.
  4. D) historical research on diseases that affect lung capacity.

Answer:  B

Topic:  24.10

Skill:  Application/Analysis

Learning Outcome:  24.8

Global LO:  2, 5

 

24.2   Art Questions

 

1) Which part of this figure shows a clone of memory cells?

 

  1. A) part A
  2. B) part B
  3. C) part C
  4. D) part D

Answer:  C

Topic:  24.8

Skill:  Knowledge/Comprehension

Learning Outcome:  24.4

Global LO:  3

 

2) Where is the antigen-binding site of this antibody?

 

  1. A) site A
  2. B) site B
  3. C) site C
  4. D) site D

Answer:  A

Topic:  24.9

Skill:  Knowledge/Comprehension

Learning Outcome:  24.6

Global LO:  3

 

24.3   Scenario Questions

 

After reading the paragraph below, answer the questions that follow.

 

To protect U.S. soldiers serving overseas, each soldier receives vaccinations against several diseases, including smallpox, before deployment. Following intelligence about an imminent smallpox threat in Iraq, the U.S. Army wants to ensure that soldiers stationed there are fully protected from exposure to the disease, so all the soldiers in the threat zone are given a second vaccination against smallpox.

 

1) The first vaccination provides immunity because

  1. A) a localized inflammatory response is initiated.
  2. B) the vaccine contains manufactured antibodies against smallpox.
  3. C) antigenic determinants in the vaccine activate B cells, which form plasma cells as well as memory cells.
  4. D) the vaccine contains antibiotics and other drugs that kill the smallpox virus.

Answer:  C

Topic:  24.8

Skill:  Application/Analysis

Learning Outcome:  24.4

Global LO:  2, 5

2) The second vaccination is beneficial because

  1. A) it contains plasma cells that survive longer than 4—5 days.
  2. B) it stimulates production of a higher concentration of antibodies in the bloodstream.
  3. C) it requires two injections to stimulate antibody formation.
  4. D) it keeps previously produced plasma cells circulating in the bloodstream.

Answer:  B

Topic:  24.8

Skill:  Application/Analysis

Learning Outcome:  24.4

Global LO:  2, 5

 

After reading the paragraph below, answer the questions that follow.

 

Consider the following statement from the textbook: “Scientists hypothesize that higher anti-HPV antibody levels provide greater protection from HPV-related cancers compared to lower levels, but they don’t yet have strong evidence to support this hypothesis.”

 

3) Suppose you design a study to test this hypothesis. Your study participants are adults between the ages of 25 and 40 (mean age = 32). From the following choices, select the groups of individuals who would make the best participants for the experimental group in your study.

  1. A) a group of 100 vaccinated adult males and a group of 100 vaccinated adult females
  2. B) a group of 100 unvaccinated adult males and a group of 100 vaccinated adult males
  3. C) a group of 50 vaccinated adult males and a group of 150 vaccinated adult females
  4. D) a group of 100 unvaccinated adult males and a group of 100 unvaccinated adult females

Answer:  A

Topic:  24.11

Skill:  Synthesis/Evaluation

Learning Outcome:  24.10

Global LO:  1, 2

 

4) Suppose you design a study to test this hypothesis. Your study participants are adults between the ages of 25 and 40 (mean age = 32). From the following choices, select the groups of individuals who would make the best participants for the control group in your study.

  1. A) a group of 100 vaccinated adult males and a group of 100 vaccinated adult females
  2. B) a group of 100 unvaccinated adult males and a group of 100 vaccinated adult males
  3. C) a group of 50 vaccinated adult males and a group of 150 vaccinated adult females
  4. D) a group of 100 unvaccinated adult males and a group of 100 unvaccinated adult females

Answer:  D

Topic:  24.11

Skill:  Synthesis/Evaluation

Learning Outcome:  24.10

Global LO:  1, 2

 

 

5) Suppose you conduct the study and obtain the results graphed above. What can you conclude about the correlation between anti-HPV antibody levels and incidence of HPV-related cancers?

  1. A) As antibody levels increase, the incidence of HPV-related cancers consistently increases.
  2. B) As antibody levels increase, the incidence of HPV-related cancers consistently decreases.
  3. C) An antibody levels increase, the incidence of HPV-related cancers consistently stays the same.
  4. D) There is no consistent correlation between anti-HPV antibody levels and the incidence of HPV-related cancers.

Answer:  D

Topic:  24.11

Skill:  Synthesis/Evaluation

Learning Outcome:  24.10

Global LO:  1, 2, 3

 

6) Suppose you conduct the study and obtain the results graphed above. How do the results of your study add to existing knowledge about whether or not higher anti-HPV antibody levels provide greater protection from HPV-related cancers?

  1. A) Your results add evidence that supports the original hypothesis.
  2. B) Your results do not provide evidence that supports the hypothesis.
  3. C) Your results neither support nor refute the hypothesis.
  4. D) Your results, if they are replicated in another study, will add evidence that supports the original hypothesis.

Answer:  C

Topic:  24.11

Skill:  Synthesis/Evaluation

Learning Outcome:  24.10

Global LO:  1, 2, 8

 

Campbell Biology: Concepts and Connections, 8e (Reece et al.)

Chapter 38   Conservation Biology

 

38.1   Multiple-Choice Questions

 

1) The primary goal of conservation biology is to

  1. A) estimate the total number of species that exist.
  2. B) maximize the land set aside for wildlife.
  3. C) integrate human culture back into nature.
  4. D) counter the loss of biodiversity.

Answer:  D

Topic:  38.7

Skill:  Knowledge/Comprehension

Learning Outcome:  38.1

Global LO:  5

 

2) By the year 1980, a wolf species (Canis rufus) once common to the southeastern region of the United States disappeared from all areas except for one small part of eastern Texas. This is an example of

  1. A) extirpation.
  2. B) extinction.
  3. C) an invasive species.
  4. D) genetic diversity.

Answer:  A

Topic:  38.1

Skill:  Application/Analysis

Learning Outcome:  38.1

Global LO:  2

 

3) The current rate of extinction may be as much as ________ times higher than at any other time in the past 100,000 years.

  1. A) 10
  2. B) 100
  3. C) 1,000
  4. D) 10,000

Answer:  C

Topic:  38.1

Skill:  Knowledge/Comprehension

Learning Outcome:  38.1

 

 

4) Biodiversity considers

  1. A) the genetic diversity within and between populations of a species.
  2. B) the fate of water in the ecosystem.
  3. C) commensal relationships between species.
  4. D) the relationships of individuals to a food chain.

Answer:  A

Topic:  38.1

Skill:  Knowledge/Comprehension

Learning Outcome:  38.1

5) Currently, the single greatest threat to biodiversity is

  1. A) global warming.
  2. B) habitat destruction due to humans.
  3. C) the introduction of exotic species.
  4. D) overexploitation of populations for food.

Answer:  B

Topic:  38.2

Skill:  Knowledge/Comprehension

Learning Outcome:  38.2

Global LO:  5

 

6) You arrive back in the United States after a visit to a foreign country located on another continent. The customs agent stops the person in front of you and confiscates the fruit basket this person is bringing home. Being the knowledgeable person you are, you calmly explain to your enraged fellow traveler that the reason for the detainment is that the fruit basket may be

  1. A) carrying endangered fruit.
  2. B) carrying an exotic species that could damage North American ecosystems.
  3. C) contaminated with chemicals that will damage the ozone layer above North America.
  4. D) contaminated with sufficient DDT to cause serious harm to anyone who eats the fruit.

Answer:  B

Topic:  38.2

Skill:  Application/Analysis

Learning Outcome:  38.2

Global LO:  2, 5

 

7) The three greatest current threats to biodiversity, in order starting with the greatest, are

  1. A) habitat loss, overharvesting, and invasive species.
  2. B) habitat loss, invasive species, and overharvesting.
  3. C) invasive species, habitat loss, and overharvesting.
  4. D) invasive species, overharvesting, and habitat loss.

Answer:  B

Topic:  38.2

Skill:  Knowledge/Comprehension

Learning Outcome:  38.2

Global LO:  5

 

 

8) Which of the following is an invasive species?

  1. A) mallard duck in the western United States
  2. B) brown tree snake in Guam
  3. C) elephant in India
  4. D) carrier pigeon in the continental United States

Answer:  B

Topic:  38.2

Skill:  Knowledge/Comprehension

Learning Outcome:  38.2

Global LO:  5, 6

9) To decrease pollution from sulfur, your local power plant built very tall smokestacks. The ultimate consequence of this would most likely be

  1. A) biological magnification.
  2. B) to dilute the sulfur pollutants in the atmosphere and thus reduce their effects on the environment.
  3. C) to create an environmental problem at a distance from the power plant.
  4. D) a decrease in the pH of local lakes.

Answer:  C

Topic:  38.2

Skill:  Application/Analysis

Learning Outcome:  38.2

Global LO:  2, 5

 

10) DDT and mercury

  1. A) were once used as an energy source.
  2. B) contribute to acid precipitation.
  3. C) accumulate in the tissues of organisms.
  4. D) deplete the ozone layer.

Answer:  C

Topic:  38.2

Skill:  Knowledge/Comprehension

Learning Outcome:  38.2

Global LO:  5

 

11) Which of the following is a likely consequence of thinning of the ozone layer?

  1. A) increases in skin cancer
  2. B) increases in escape of heat from Earth
  3. C) global warming
  4. D) decreases in flying insect populations

Answer:  A

Topic:  38.2

Skill:  Knowledge/Comprehension

Learning Outcome:  38.2

Global LO:  5, 6, 8

 

 

12) You spray your lawn with a pesticide. The concentration of the pesticide in the tissues of the grass on your lawn is 10-6 parts per million (ppm). Grasshoppers eat the grass and are in turn eaten by rats, which are then eaten by owls. At each successive trophic level, the concentration of pesticides increases. The term for this process is

  1. A) extirpation.
  2. B) biological magnification.
  3. C) habitat loss.
  4. D) climate change.

Answer:  B

Topic:  38.2

Skill:  Application/Analysis

Learning Outcome:  38.2

Global LO:  5

13) Global warming is the result of

  1. A) rising ocean levels.
  2. B) rising concentrations of greenhouse gases.
  3. C) increased solar activity.
  4. D) habitat loss.

Answer:  B

Topic:  38.3

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

Global LO:  5, 8

 

14) Greenhouse gases include

  1. A) nitrous oxide and oxygen.
  2. B) nitrogen and oxygen.
  3. C) carbon dioxide and nitrogen.
  4. D) carbon dioxide and methane.

Answer:  D

Topic:  38.3

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

Global LO:  5

 

15) The average global temperature has risen ________ over the past 100 years.

  1. A) 3°C
  2. B) 10°C
  3. C) 5°C
  4. D) 0.8°C

Answer:  D

Topic:  38.3

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

Global LO:  5

 

16) CO2 in the atmosphere is absorbed by ________ and converted into biomass.

  1. A) the ozone layer
  2. B) other atmosphere gases
  3. C) photosynthetic organisms
  4. D) large land masses

Answer:  C

Topic:  38.4

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

Global LO:  5

17) Scientists worry that global warming will result in the oceans

  1. A) becoming more acidic.
  2. B) becoming more basic.
  3. C) containing less dissolved oxygen.
  4. D) containing less dissolved carbon dioxide.

Answer:  A

Topic:  38.4

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

Global LO:  5, 8

 

18) One way in which populations and species have been responding to climate change is by

  1. A) changing their coat color.
  2. B) shifting their distribution.
  3. C) changing their metabolism.
  4. D) evolving a flexible mode of reproduction.

Answer:  B

Topic:  38.5

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

 

19) Which of the following is not an observed effect of global warming on organisms?

  1. A) Some species of birds and frogs now begin their breeding seasons later in the year.
  2. B) Corals “bleach” when increased water temperatures cause them to expel their symbiotic algae.
  3. C) Many butterfly populations have shifted their ranges to the north.
  4. D) Many polar bears show signs of starvation as their hunting grounds melt away.

Answer:  A

Topic:  38.5

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  2, 8

 

 

20) The ability to change phenotype in response to local environmental conditions is called

  1. A) genetic drift.
  2. B) mutation.
  3. C) alteration of generations.
  4. D) phenotypic plasticity.

Answer:  D

Topic:  38.6

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

 

21) Some populations, especially those with high genetic variability and short life spans, may avoid extinction as the climate changes through

  1. A) enforcement of the Endangered Species Act.
  2. B) bioprospecting.
  3. C) distribution of populations.
  4. D) evolutionary adaptation.

Answer:  D

Topic:  38.6

Skill:  Knowledge/Comprehension

Learning Outcome:  38.3

22) Protecting the endangered black-footed ferret from extinction involved

  1. A) captive breeding and reintroduction.
  2. B) collecting individuals from multiple small populations and combining them into a single large population.
  3. C) vaccinating the remaining population against sylvatic plague.
  4. D) providing food during harsh winters.

Answer:  A

Topic:  38.7

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

 

23) Captive breeding

  1. A) has allowed for the reintroduction of many species to areas from which they had disappeared.
  2. B) has advanced to the point where biologists believe it can be used to save most endangered species.
  3. C) can work for animals but is generally not used for endangered plants.
  4. D) is the main conservation technique used to try to save endangered species from extinction.

Answer:  A

Topic:  38.7

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

 

 

24) A regional assemblage of interacting ecosystems is a

  1. A) biome.
  2. B) landscape.
  3. C) corridor.
  4. D) hot spot.

Answer:  B

Topic:  38.8

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

 

25) Movement corridors

  1. A) increase inbreeding.
  2. B) reduce dispersal.
  3. C) can be harmful because they allow for the spread of disease.
  4. D) can be harmful because they allow for gene flow.

Answer:  C

Topic:  38.8

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

26) Which of the following statements about movement corridors is true?

  1. A) Movement corridors can connect otherwise isolated habitat patches.
  2. B) Movement corridors can promote inbreeding in declining populations.
  3. C) Movement corridors are detrimental to species that migrate between habitats seasonally.
  4. D) Movement corridors can prevent the spread of disease.

Answer:  A

Topic:  38.8

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

 

27) Habitats with many edges

  1. A) are the result of natural disasters.
  2. B) favor animals that prefer large, open ranges.
  3. C) often result from human activities.
  4. D) result in a significant increase in diversity.

Answer:  C

Topic:  38.8

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

 

 

28) Small areas that are home to a large number of threatened species and an exceptional concentration of species found nowhere else on Earth are called

  1. A) biomes.
  2. B) movement corridors.
  3. C) biodiversity hot spots.
  4. D) local populations

Answer:  C

Topic:  38.9

Skill:  Knowledge/Comprehension

Learning Outcome:  38.5

 

29) Species found in only one place on Earth are called ________ species.

  1. A) hot spot
  2. B) exotic
  3. C) keystone
  4. D) endemic

Answer:  D

Topic:  38.9

Skill:  Knowledge/Comprehension

Learning Outcome:  38.5

 

30) Most biodiversity hot spots are found in ________ regions.

  1. A) western
  2. B) tropical
  3. C) temperate
  4. D) tundra

Answer:  B

Topic:  38.9

Skill:  Application/Analysis

Learning Outcome:  38.5

Global LO:  2, 6

31) About one-third of all animal and plant species are concentrated on ________ of Earth’s land.

  1. A) 20%
  2. B) 10%
  3. C) 5%
  4. D) 1.5%

Answer:  D

Topic:  38.9

Skill:  Knowledge/Comprehension

Learning Outcome:  38.5

 

 

32) The greatest challenge facing the zoned reserve systems of Costa Rica is

  1. A) high predation by jaguars.
  2. B) forest fires.
  3. C) soil erosion.
  4. D) the growing human population.

Answer:  D

Topic:  38.10

Skill:  Knowledge/Comprehension

Learning Outcome:  38.6

Global LO:  5

 

33) One result of Costa Rica’s commitment to conservation is that

  1. A) destructive practices such as massive logging and large-scale single-crop agriculture have been nearly eliminated.
  2. B) both protected park areas and the buffer zones around them have suffered only negligible deforestation.
  3. C) ecotourism generates many jobs and brings in a significant fraction of the country’s revenue.
  4. D) about 95% of the country’s land is protected in some way.

Answer:  C

Topic:  38.10

Skill:  Knowledge/Comprehension

Learning Outcome:  38.6

Global LO:  5

 

34) The introduction of wolves into Yellowstone National Park in 1991 resulted in

  1. A) a general decline in overall habitat
  2. B) ecological changes involving numerous plant and animal species.
  3. C) the migration of most of these wolves out of the park and back to Canada.
  4. D) the death of all of the wolves, likely due to an insufficient amount of available prey.

Answer:  B

Topic:  38.11

Skill:  Knowledge/Comprehension

Learning Outcome:  38.7

Global LO:  5

35) The Yellowstone to Yukon Conservation Initiative is a plan to

  1. A) connect all of the national parks in the western United States.
  2. B) connect all of the national parks in the United States.
  3. C) connect parks in the United States and Canada with protected corridors where wildlife can travel safely.
  4. D) create a giant, fenced private land area between the national parks in the United States to create a protected zone for wildlife.

Answer:  C

Topic:  38.11

Skill:  Knowledge/Comprehension

Learning Outcome:  38.7

Global LO:  5

 

36) If wolves were now removed from Yellowstone National Park,

  1. A) elk populations would increase.
  2. B) deer populations would decrease.
  3. C) the vegetation would remain unchanged.
  4. D) vegetation would increase, providing shelter for smaller animals.

Answer:  A

Topic:  38.11

Skill:  Application/Analysis

Learning Outcome:  38.7

Global LO:  2

 

37) The aspect of conservation ecology concerned with returning degraded ecosystems (as nearly as possible) to their natural state is

  1. A) bioremediation.
  2. B) sustainable development.
  3. C) restoration ecology.
  4. D) landscape ecology.

Answer:  C

Topic:  38.12

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  6

 

38) Using living organisms to clean up polluted ecosystems is known as

  1. A) migration.
  2. B) restoration ecology.
  3. C) bioremediation.
  4. D) landscaping.

Answer:  C

Topic:  38.12

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5, 6

39) The Kissimmee River Restoration Project is an

  1. A) example of large-scale bioremediation to clean up a mercury spill.
  2. B) example of a dam that interrupted the breeding of salmon and other species.
  3. C) attempt to restore the natural wetlands associated with the Kissimmee River.
  4. D) effort to join two previously unconnected lakes to permit better drainage.

Answer:  C

Topic:  38.12

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

 

 

40) The Kissimmee River Restoration Project is intended to

  1. A) drain natural wetlands in the central Florida region.
  2. B) increase biodiversity of the region.
  3. C) restrict ecotourism and other recreational usage in the impacted region.
  4. D) provide areas for homes and businesses.

Answer:  B

Topic:  38.12

Skill:  Knowledge/Comprehension

Learning Outcome:  38.4

Global LO:  5

 

41) Sustainable development

  1. A) will require making difficult decisions regarding travel to other planets.
  2. B) will require many people to contribute financially.
  3. C) will speed up evolution.
  4. D) will require global, multinational cooperation.

Answer:  D

Topic:  38.13

Skill:  Knowledge/Comprehension

Learning Outcome:  38.8

Global LO:  5

 

42) Araschnia levana is a species of butterfly that breeds several times a year. It has two distinctly colored pupae: Those that emerge in spring are orange and those that emerge in summer are brown. The seasonal color variations in pupae mean that the pupae blend into the colors in their environment. This is an example of

  1. A) a threatened species.
  2. B) an endemic species.
  3. C) a keystone species.
  4. D) phenotypic plasticity.

Answer:  D

Topic:  38.6

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  2, 6

 

43) Suppose a species of wild boar (a type of pig) is actively hunted when it is at a young age because at that stage of its development the meat of the boar is particularly tender. What is a likely outcome if this species is overharvested?

  1. A) The wild boar population will dwindle because their food source will disappear due to habitat loss.
  2. B) The wild boar population will increase because older boars will continue to survive.
  3. C) The wild boar population will dwindle and potentially go extinct if not enough boars that can reproduce are left to mate.
  4. D) The wild boar population will increase because boundaries will help separate boars from humans.

Answer:  C

Topic:  38.2

Skill:  Application/Analysis

Learning Outcome:  38.2

Global LO:  2

 

44) As global temperatures continue to rise, what is a likely outcome?

  1. A) loss of populations of fish
  2. B) greater overharvesting of medicinal plant species
  3. C) less greenhouse gas emissions
  4. D) formation of new glaciers

Answer:  A

Topic:  38.3

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  2, 5

 

45) If current trends in global warming continue for the next 50 years, where will the greatest effects of global warming likely be felt?

  1. A) the continental United States
  2. B) the Pacific Ocean
  3. C) the Mississippi River
  4. D) Russia

Answer:  D

Topic:  38.3

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  2, 5

 

 

46) While habitat destruction by humans creates fragmented ecosystems, fragmentation can also occur due to natural processes. Which of the following natural processes would most likely create a fragmented ecosystem?

  1. A) thunderstorm
  2. B) glacier movement
  3. C) blizzard
  4. D) volcanic eruption

Answer:  D

Topic:  38.8

Skill:  Application/Analysis

Learning Outcome:  38.4

Global LO:  2

47) In Clackamas, Oregon, a stand of hybrid poplar trees was planted on an area of land that is contaminated with volatile organic compounds (VOCs). Why would someone purposely plant trees in an area with contaminated soil?

  1. A) to use the trees as a means of phytoremediation
  2. B) to use the trees as a means of eliminating insect species that consume nearby endemic plants
  3. C) to use the trees for lumber for houses
  4. D) to see if animals will make nests in trees that grow in contaminated soil.

Answer:  A

Topic:  38.12

Skill:  Application/Analysis

Learning Outcome:  38.4

Global LO:  2

 

48) Which of the following is not an example of a predicted impact of climate change?

  1. A) Wildfires in Colorado will increase in severity.
  2. B) Wildflower diversity in northeastern United States will increase.
  3. C) Spring seasonal temperatures will continue to increase.
  4. D) Australian coral reefs will experience greater loss of marine life.

Answer:  B

Topic:  38.5

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  2, 5

 

 

49) You are a climate scientist who wants to investigate climate change. Which of the following measurements would be the least useful?

  1. A) rainfall in the southeastern United States from 20 years ago to the present day
  2. B) a long-term (30-year) study of coral biodiversity in the Australian reef ecosystem
  3. C) changes in carbon dioxide (CO2) emission levels in China from 25 years ago to the present day
  4. D) methane (CH4) levels from dairy farms in Iowa during the years 2011 and 2012

Answer:  D

Topic:  38.4

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  1, 2, 5

 

38.2   Art Questions

 

1) According to this figure, which organisms have the highest concentration of PCBs, and why?

 

 

  1. A) phytoplankton, because they are at the bottom of the food chain
  2. B) herring gulls, because they are at the bottom of the food chain
  3. C) herring gulls, because they are at the top of the food chain
  4. D) smelt, because they are in the middle of the food chain

Answer:  C

Topic:  38.2

Skill:  Application/Analysis

Learning Outcome:  38.2

Global LO:  2, 3

 

2) According to this graph of changes in Earth’s atmosphere, which of the following took place between the years 1800 and 2000?

 

 

  1. A) Nitrous oxide (N2O) levels increased from 270 ppb to 390 ppb.
  2. B) Carbon dioxide (CO2) levels increased from 950 ppb to 1,800 ppb.
  3. C) Carbon dioxide (CO2) levels increased from 290 ppm to 380 ppm.
  4. D) Methane (CH4) levels increased from 270 ppm to almost 2,000 ppm.

Answer:  C

Topic:  38.4

Skill:  Application/Analysis

Learning Outcome:  38.3

Global LO:  2, 3

 

3) The figure below depicts natural fluctuation of ozone levels in Switzerland between 1925 and 1976. Dobson units are a way to measure the total amount of atmospheric ozone above a point on the Earth’s surface.

 

 

What can you conclude from this figure?

  1. A) Natural fluctuation of ozone levels varies greatly year to year, so the average for this 50-year span was approximately 330 Dobson units.
  2. B) Switzerland can be used as a model example of how to maintain safe ozone levels.
  3. C) All small European countries will show fluctuations in ozone concentration levels.
  4. D) Ozone levels show a distinct pattern of increasing by 10 Dobson units every 10 years.

Answer:  A

Topic:  38.2

Skill:  Synthesis/Evaluation

Learning Outcome:  38.2

Global LO:  2, 3, 5

 

38.3   Scenario Questions

 

After reading the paragraphs below, answer the questions that follow.

 

Introduced species are a problem all over the world, and there are many examples in the United States. Several years ago, a fisherman caught a northern snakehead fish in a pond in Crofton, Maryland (a suburb of Washington, DC). Snakeheads are a favorite food of immigrants from China, and live fish can frequently be found in Asian markets. It was suspected that the fish in the Crofton pond were purchased locally and then intentionally released.

 

Snakeheads are top predators, and 90% of the northern snakeheads’ diet consists of other fishes. The northern snakehead can breathe out of water and travel short distances (about 100 feet) across land. They also breed rapidly. Females can lay more than 100,000 eggs per year. Juveniles have also been identified in the Potomac River and other rivers in Pennsylvania.

 

1) When snakeheads enter aquatic ecosystems, biodiversity in these ecosystems would most likely

  1. A) increase, since another species has been added to the environment.
  2. B) decrease, since the snakehead will prey on native species.
  3. C) remain the same, since local species will prey on the snakeheads and remove them.
  4. D) remain the same, because the snakeheads will merge without problems into established communities.

Answer:  B

Topic:  38.1, 38.2

Skill:  Application/Analysis

Learning Outcome:  38.4

Global LO:  2, 5

 

2) Based on the characteristics of the snakehead described, which of the following is most likely to be a productive strategy to reduce the spread of this species?

  1. A) extending the fishing season for prey fishes
  2. B) introducing a natural predator to feed on juvenile snakeheads
  3. C) capturing breeding snakeheads and sterilizing them so that they cannot breed any longer
  4. D) introducing algae and photosynthetic bacteria to reduce nutrient levels in the water

Answer:  B

Topic:  38.2

Skill:  Synthesis/Evaluation

Learning Outcome:  38.4

Global LO:  2, 5


After reading the paragraph below, answer the question that follows.

 

Rice is a staple crop across Asia; it serves as a main nutritional source for Asia’s high population. In the 1970s, a pathogen called the grassy-stunt virus greatly decreased cultivated rice plant populations. Scientists found one wild relative of the rice plant in India that was resistant to the grassy-stunt virus, and today hybrid rice plants with that resistant gene are grown across Asia. To find this one rice plant species, approximately 17,000 rice plants samples were tested over the course of four years.

 

3) If you were a scientist working on this project, how would you argue that the results of the research would be worth the time investment?

  1. A) Finding the wild relative with disease resistance would help avoid extirpation of fungus that has a mutualistic relationship with the cultivated rice plants.
  2. B) Finding the wild relative with disease resistance would protect the continent of Asia as a biodiversity hot spot.
  3. C) Finding the wild relative with disease resistance would allow Asian farmers to continue to grow the crop they know.
  4. D) Finding the wild relative with disease resistance would help deter invasive species of rice plants.

Answer:  C

Topic:  38.1

Skill:  Synthesis/Evaluation

Learning Outcome:  38.4

Global LO:  2, 5, 6

 

After reading the paragraph below, answer the questions that follow.

 

As the climate warms, organisms will shift their population ranges to different areas that are cooler. However, as humans continue to fragment large tracts of land, species will face increasing challenges in adapting their ranges to new climates. For example, movement corridors may not be able to be built if the amount of land needed for a species’ range is fragmented due to cities and roads. One alternative to creating movement corridors is called managed relocation. This requires physically moving species to cooler climates.

 

4) Which of the following is an advantage of using managed relocation?

  1. A) Scientists will be able to accurately predict how many members of a species will survive the relocation because they can start the process with a definite number of members being moved.
  2. B) Purposefully moving species will allow scientists to put specific numbers of organisms in different areas so that the species population always maintains an even distribution of organisms across the area.
  3. C) All species moved will be saved from extinction.
  4. D) Governments will not face the large costs of maintaining conserved areas for corridors.

Answer:  D

Topic:  38.8

Skill:  Synthesis/Evaluation

Learning Outcome:  38.3

Global LO:  2, 5

5) Which of the following is a disadvantage of using managed relocation?

  1. A) Many vehicles will be needed to transport the species, so CO2emissions from the vehicles will cause an increase in global greenhouse gas levels.
  2. B) Governments will face long-term high fuel costs for the many vehicles that will be needed to move the species.
  3. C) Scientists may move the species to ranges where they will become invasive.
  4. D) Local economies will see an increase in jobs as many individuals will need to be hired to help move the species.

Answer:  C

Topic:  38.8

Skill:  Synthesis/Evaluation

Learning Outcome:  38.3

Global LO:  2, 5

Reviews

There are no reviews yet.

Be the first to review “Campbell Biology Concepts And Connections 8th Edition By Reece, Taylor – Test Bank”

Your email address will not be published. Required fields are marked *